ID: 1058893549

View in Genome Browser
Species Human (GRCh38)
Location 9:109381361-109381383
Sequence TAGGTGGGTCGGTGCGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058893536_1058893549 5 Left 1058893536 9:109381333-109381355 CCACTGAGCCAAAAGGAGTACCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1058893549 9:109381361-109381383 TAGGTGGGTCGGTGCGGGGGAGG No data
1058893538_1058893549 -3 Left 1058893538 9:109381341-109381363 CCAAAAGGAGTACCCAGGTCTAG 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1058893549 9:109381361-109381383 TAGGTGGGTCGGTGCGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058893549 Original CRISPR TAGGTGGGTCGGTGCGGGGG AGG Intronic
No off target data available for this crispr