ID: 1058895511

View in Genome Browser
Species Human (GRCh38)
Location 9:109397457-109397479
Sequence GTGGGCTCTTTGGGAAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058895511_1058895521 5 Left 1058895511 9:109397457-109397479 CCCATTTTTCCCAAAGAGCCCAC 0: 1
1: 0
2: 1
3: 27
4: 183
Right 1058895521 9:109397485-109397507 GAGGTTGTTTTAGTACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058895511 Original CRISPR GTGGGCTCTTTGGGAAAAAT GGG (reversed) Intronic
900470920 1:2854561-2854583 GTGGGCTCTTCTGAAAAAAGCGG + Intergenic
900963191 1:5938829-5938851 ATCGGCTATTTTGGAAAAATCGG + Intronic
901599407 1:10411043-10411065 GTGGTAACTTTGGGAAAAAGAGG + Intronic
902081753 1:13825798-13825820 GTAGGGGCTTTGGGAGAAATGGG - Intergenic
904273366 1:29364703-29364725 GTGGGCGCTTTAGGAAAATGTGG + Intergenic
904976725 1:34462181-34462203 CTGGGATCTTTGGGAGAGATGGG + Intergenic
906876631 1:49546034-49546056 GTGGGGACTTTGGGGAAAAGTGG - Intronic
906934642 1:50201875-50201897 GTGGTCTCTTTGCTGAAAATGGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908760313 1:67505539-67505561 GTGGCCTACTTGGGAAAACTGGG + Intergenic
908844852 1:68314370-68314392 GTGGGCTGAGTGGGAACAATGGG - Intergenic
910401372 1:86841236-86841258 ATGGGCTCTTTAGGAAAGACAGG + Intergenic
913263114 1:117018803-117018825 GTGGGAACTTAGGGGAAAATGGG - Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
921136256 1:212261807-212261829 GTGGGAACATTTGGAAAAATTGG - Intergenic
921181025 1:212631178-212631200 CTGGGCTCTTTGAGAACAAAAGG + Intergenic
922064645 1:222125029-222125051 ATGGGCTGTTTAGGATAAATAGG + Intergenic
922885213 1:229014935-229014957 GTGGCCTCCCTGGGAAAACTTGG + Intergenic
924583570 1:245342575-245342597 CCCGGGTCTTTGGGAAAAATAGG - Intronic
924892691 1:248300530-248300552 GTGGGCTTTTAAGGAAAATTGGG + Intergenic
1063511469 10:6648440-6648462 GTGGACTATTTGGGAAAAGAAGG - Intergenic
1065174262 10:23061764-23061786 GTGGACACTTGTGGAAAAATGGG + Intergenic
1065516071 10:26525524-26525546 GTGGTCTCTTTTGGGAAAGTGGG + Intronic
1067332955 10:45338818-45338840 GAGGTCTCCTTGGGAAAAAATGG - Intergenic
1067800826 10:49358221-49358243 GTGTTCTCTTTGGGAGAAGTTGG + Intergenic
1068659972 10:59613610-59613632 GTGGGGCCTTTGGGGATAATTGG - Intergenic
1070615738 10:77967985-77968007 GGGCCCTCTTTGGGCAAAATTGG + Intergenic
1071542091 10:86495002-86495024 GTGGGCTCTTCAGGTAAAATAGG + Intronic
1074715185 10:116211573-116211595 CTGTGCTCTTTGGGGAACATGGG - Intronic
1076264359 10:129098298-129098320 GTGAAGTCTTTGGGACAAATAGG - Intergenic
1078275718 11:9843815-9843837 GTGGGCTTTCTGGCAAAAACTGG + Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087610791 11:100432046-100432068 GTGGGGTCTTTAGGAACAAATGG - Intergenic
1089048348 11:115523893-115523915 GAGGTCTCTTTGGGATGAATTGG - Intergenic
1089321228 11:117627963-117627985 ATGGGCTCTGTGGGAAATACAGG - Intronic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1089340851 11:117756336-117756358 GTGGGATTTTTGGGAAAACCAGG + Intronic
1090438929 11:126710346-126710368 GAGGGCTCAATGGGAAGAATGGG - Intronic
1090487262 11:127124790-127124812 GTGGGATCTTTGGGAAGATATGG + Intergenic
1091448386 12:557877-557899 GTGAGCCCTCTGGGAAAAGTTGG - Intronic
1091688651 12:2581187-2581209 GGGGGCTCTTTGGGGAAAGGTGG + Intronic
1092499742 12:9033510-9033532 GAGGGCACTTTGGGGAAATTGGG + Intergenic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1094025296 12:25955475-25955497 GTGGGCTGTTTGGGAAATACTGG + Intergenic
1094070905 12:26412099-26412121 GATGGCTCTATGGGAAAAATAGG - Intronic
1094217469 12:27959076-27959098 GTGTGGACTTTGGGAACAATTGG + Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097769792 12:63570504-63570526 GTTGTCACTTTGGGAAAAACTGG + Intronic
1098546578 12:71718211-71718233 TTCAGCTCTTAGGGAAAAATGGG - Intergenic
1101004774 12:100390927-100390949 GTAGGCTCATTGGTAAAAAATGG + Intronic
1102926402 12:116829436-116829458 GAGGGCCCTTTGGGAAACAATGG + Intronic
1103012073 12:117465434-117465456 GAGGGCCCTTTGGGAAACACAGG + Exonic
1103635583 12:122302472-122302494 GGGGACCCATTGGGAAAAATTGG - Intronic
1104531079 12:129571667-129571689 GTGGGCTCATTTCGAAAAAGGGG + Intronic
1105569420 13:21587199-21587221 ATGGACTCTTTGAGTAAAATGGG + Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116473857 14:45317504-45317526 GTGTGTTCTTTTGGAAGAATGGG - Intergenic
1117031348 14:51674188-51674210 GTGGGCTTTCTAGGAAAAGTTGG - Intronic
1118309676 14:64683209-64683231 GTGGGGGCTTTGGGACAAAATGG - Intergenic
1118919566 14:70137835-70137857 TTTGGCTCCCTGGGAAAAATGGG + Intronic
1121205920 14:92167326-92167348 GTGGGCTTTTTTGCAGAAATTGG - Exonic
1124125088 15:26931632-26931654 ATGGGCACTTTTGGAAAATTGGG + Intronic
1126305234 15:47248438-47248460 CTGGGCACTTTGGGGTAAATTGG - Intronic
1126863381 15:52909657-52909679 GTAGGGTATTTGGTAAAAATTGG - Intergenic
1127462799 15:59215051-59215073 GTGGGTTCTTTGTGTGAAATAGG - Intronic
1128231882 15:66040931-66040953 GTGGCCTCTTTGTGAAAACCGGG - Intronic
1128822843 15:70676335-70676357 GTTGCCTCTTTGGCAAAACTGGG - Intronic
1131299524 15:91184457-91184479 GTTGTTTCTTGGGGAAAAATTGG + Intronic
1131455097 15:92577208-92577230 GTAGCATCTTGGGGAAAAATAGG - Intergenic
1132223479 15:100123075-100123097 GTGGGGTCCTTGGGAAAGTTGGG - Intronic
1132942472 16:2514790-2514812 GTGGGCTGTTTGGGAAAGCTGGG + Intronic
1137787002 16:51147852-51147874 GTGGGCTCTTTACTACAAATTGG - Intronic
1138179973 16:54934623-54934645 GCGGGCTGTTTGGGAGAGATTGG + Intergenic
1139645184 16:68324259-68324281 ATGGGATCATTGGGAAAAGTTGG + Intronic
1141393222 16:83681679-83681701 GGGAGCTCTTTGGGAAAAAGAGG + Intronic
1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG + Intergenic
1146473537 17:33143729-33143751 GGGGGTTTTTTTGGAAAAATTGG - Intronic
1148913872 17:50958128-50958150 GAGGGGTCTTTGGGAAGAAACGG + Intergenic
1150037312 17:61817851-61817873 GTGTGCTCATAGGTAAAAATGGG + Intronic
1151250772 17:72832885-72832907 GCTGGGGCTTTGGGAAAAATGGG + Intronic
1151335009 17:73434562-73434584 GTGGGCTCCTCAGGAAGAATGGG - Intronic
1153853606 18:9122067-9122089 GTAGGCTGTTTGGAAAAAATTGG + Intronic
1154331665 18:13434673-13434695 ATGGGCTATTTGGGAAACTTTGG - Intronic
1155829863 18:30500569-30500591 GTGGGACCTTTGGGTATAATTGG + Intergenic
1158471563 18:57741765-57741787 GGGGGCTCTTTGGAATAACTTGG - Intronic
1159473874 18:68891964-68891986 GTGGGTTCTATGGGAGAAAGTGG + Intronic
1162569115 19:11460579-11460601 CTGGTGTGTTTGGGAAAAATGGG - Intronic
1162937825 19:13990324-13990346 AGGGGATCTTTGGGAAAAAGGGG + Intronic
1162959038 19:14115494-14115516 GAGGGCTCCTTTGGAAAATTTGG + Intronic
1163291427 19:16381737-16381759 GTCGGCTGTTTGGGAAAGAATGG + Intronic
1165785590 19:38459898-38459920 GGGGGGTCTTTGGAATAAATGGG - Intronic
1166482166 19:43183525-43183547 ATGGGCACTTTGGGAAACACAGG + Intronic
1166484649 19:43202643-43202665 ATGGGCACTTTGGGAAACACAGG + Intronic
1167399572 19:49255890-49255912 GTGGGCTCCTAGGGGAAAATGGG - Intergenic
928867194 2:35930996-35931018 GTAAGTTCTTTGGGAAAAAAAGG - Intergenic
929945810 2:46370961-46370983 GTGGGCTCCTTGGGAACAAGGGG + Intronic
930184534 2:48399377-48399399 GTGGGCTCTTTGAGAACAGTGGG + Intergenic
931973144 2:67612693-67612715 GTTGCCTCTTTGGGAAAAATTGG - Intergenic
934692393 2:96371697-96371719 TTGGGCTGTTTGAGAAAACTGGG + Intronic
936398057 2:112144235-112144257 ATCGTCTATTTGGGAAAAATCGG - Intronic
938747149 2:134290163-134290185 GTGTGCACTTTTGGAAAGATGGG - Intronic
939933452 2:148259406-148259428 ATGGGCTCTGAGGGAAACATGGG - Intronic
940368468 2:152875230-152875252 GTGGAGTCTTTGGGAGCAATAGG - Intergenic
945874173 2:215260505-215260527 GTGAGCTCCTTGGGAACAAAGGG + Intergenic
946120414 2:217508022-217508044 ATGGGTTCTTTGGGGAAAAAAGG - Intronic
947812478 2:233013187-233013209 GTGGGCTCTCTGGGACAGAGTGG - Exonic
948278734 2:236730147-236730169 GTGGACTCTGTGGGGAAAACAGG - Intergenic
1168896710 20:1328715-1328737 GTGGATTCCTTGGGAGAAATGGG + Intronic
1169723046 20:8700058-8700080 TTGGGCTCTTTAAGAAAAAGTGG + Intronic
1170930318 20:20763861-20763883 CTGGGCTCCTTGGGAGAACTGGG + Intergenic
1172874661 20:38156904-38156926 GTGTCCTCTTTGGGAAGAAGAGG - Intronic
1174889001 20:54369367-54369389 GTGGGCTCTTTCGGATGATTAGG + Intergenic
1175735443 20:61382877-61382899 GTGAGCTTATTTGGAAAAATGGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952714173 3:36462139-36462161 GTTGGCTGTATGGGAAAAATAGG + Intronic
953232551 3:41077658-41077680 GTGGGCCCTAGGGCAAAAATGGG + Intergenic
957330108 3:78751886-78751908 GTGGGTATCTTGGGAAAAATAGG + Intronic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
963039341 3:141057124-141057146 GTGAGCTCTTGGGGAAGAAAGGG + Intronic
964621010 3:158720144-158720166 GTGCGGTATTTGGGAAAAACGGG - Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966129265 3:176618283-176618305 GTGGGACATTTGGGAAAAAAAGG - Intergenic
966472655 3:180308851-180308873 GTGGGCTATTTGGGAATCAATGG + Intergenic
969870970 4:10104562-10104584 GTGGACTTTGTGGCAAAAATGGG + Intronic
969893468 4:10280736-10280758 GTTGGCTCTTGAGGAAAGATGGG + Intergenic
971892770 4:32545491-32545513 GTGGGCTGTTTGGGGAAAGAAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
977317963 4:95475026-95475048 GTGGGCTCTCTGGGATGAAGTGG - Intronic
978661417 4:111131477-111131499 GGGGGCTCTTGGGGGAAAGTGGG - Intergenic
979402430 4:120265250-120265272 GTGGACTCTTTGGGGTAACTTGG + Intergenic
982713662 4:158784179-158784201 CTGGGCTCTTTGGCAAATATTGG - Intronic
982975909 4:162059786-162059808 GTGGACTCTGTGGGAAAAGATGG + Intronic
982980418 4:162127159-162127181 TTTAGCTCTTTGGGGAAAATGGG - Intronic
983636254 4:169900585-169900607 GTGGGTTCTTGGGTAAATATCGG + Intergenic
986426271 5:7635058-7635080 GTGGCCTGTTTGAGAAACATAGG + Intronic
988215659 5:28268778-28268800 GTGGGCTATTTAAGGAAAATTGG + Intergenic
996986741 5:129576610-129576632 AGGGGCTATTTGGAAAAAATGGG - Intronic
997441336 5:133910825-133910847 CTGGGCCCTTTGGGAAAAGTTGG + Intergenic
997939651 5:138145634-138145656 GTGGGTACTTTGGGATAAATCGG + Intronic
999193584 5:149766824-149766846 GTGGCCTCTTTGGGGAAAGTAGG + Intronic
1003002323 6:2347756-2347778 GAGGGTTGTTTGGGAAAAGTAGG - Intergenic
1004800893 6:19146048-19146070 GTGGGTTCTCTGCTAAAAATGGG - Intergenic
1007740356 6:44006003-44006025 GGGGGTTCTTTGGTCAAAATAGG + Intergenic
1008156876 6:48026419-48026441 GTGGTCTCTTTGGGGAACTTAGG + Intronic
1008737202 6:54559560-54559582 GTGAGACCTTTGAGAAAAATAGG + Intergenic
1009299541 6:61997494-61997516 GAGGGATGTTTGGGAAAAACTGG - Intronic
1010080663 6:71857122-71857144 GTGGGGCCTTTGGGAGTAATTGG + Intergenic
1011651149 6:89507601-89507623 GTGGCCTCATTGGAAGAAATAGG + Intronic
1014518890 6:122414066-122414088 GTGGACTCTTAGGAAAAAGTAGG + Intronic
1014914487 6:127129415-127129437 GGGGGCTCTTTGGGATAATATGG + Intronic
1015854037 6:137604404-137604426 GTGGGCTCTGTGAGAAACAAGGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1016796134 6:148119566-148119588 CTGGGCTCTTTGGAAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018313808 6:162537268-162537290 GTAGGCATTTTGGGAAATATGGG - Intronic
1019909370 7:4089847-4089869 GAGGGCTTTTGGGGAAAACTGGG - Intronic
1020033784 7:4951491-4951513 GTGGGCTCTTCAGGATGAATAGG - Intronic
1021824608 7:24536758-24536780 GTAGTCTCTTTGGGAAGAGTTGG - Intergenic
1023304611 7:38812262-38812284 GTGGGCCCTTTGTGGAAAATTGG - Intronic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026252478 7:68682990-68683012 GTAGGCTGTTTAAGAAAAATGGG - Intergenic
1026735736 7:72947434-72947456 GGGCCCTGTTTGGGAAAAATAGG - Intronic
1026786079 7:73302365-73302387 GGGCCCTGTTTGGGAAAAATAGG - Intergenic
1027107986 7:75417577-75417599 GGGCCCTGTTTGGGAAAAATAGG + Exonic
1027337434 7:77167735-77167757 GTGGGCACTATGGCATAAATGGG - Exonic
1028918663 7:96287420-96287442 GTGGAATCTTTGGTATAAATGGG - Intronic
1029640638 7:101817043-101817065 GGGGGCTCTTTGGGGAAACTTGG + Intronic
1029778363 7:102703382-102703404 GTGGGCACTATGGCATAAATGGG + Intergenic
1030108273 7:106005475-106005497 GAGGGCTCTTTGGGAGGAATTGG + Intronic
1031053659 7:116970980-116971002 GTGGTCTCTTTGGGTCCAATTGG - Intronic
1031218077 7:118923515-118923537 ATGGTCTATTTTGGAAAAATTGG - Intergenic
1032689973 7:134276103-134276125 GTGCCCTCTTTGGGAGAACTGGG - Intergenic
1034221671 7:149451247-149451269 GTGGGCTCTTGGGAAAAGAAGGG - Intronic
1036027625 8:4927867-4927889 GTGGGATCTTTGGGGAATCTTGG - Intronic
1037775434 8:21832599-21832621 AGGGGCTTTTTGGGGAAAATGGG - Intergenic
1046884253 8:119345845-119345867 GTGAGATCTTTGGAAAAATTTGG - Intergenic
1046910558 8:119621738-119621760 TTGGGTTCCTTTGGAAAAATGGG + Intronic
1048452770 8:134548641-134548663 GCAGGCACTTTGGGAAAAATAGG + Intronic
1050501740 9:6305420-6305442 GAGGGCTCTTTGGGGGATATTGG + Intergenic
1050738913 9:8797172-8797194 GGGGGCTTTCTGGCAAAAATTGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052977432 9:34421610-34421632 GGGGGCTCTTTGGGAAATGTTGG - Intronic
1055859311 9:80729870-80729892 GGGATCCCTTTGGGAAAAATGGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1058630093 9:106977611-106977633 CTTGGTTCTTTGGGCAAAATGGG + Intronic
1058895511 9:109397457-109397479 GTGGGCTCTTTGGGAAAAATGGG - Intronic
1059637914 9:116188451-116188473 CTGGGCTCTTTGAGAAAACAGGG - Intronic
1059985677 9:119818180-119818202 GTTGGGTATTTGGGAAAAATTGG - Intergenic
1060337677 9:122742073-122742095 CTGAGCTCTGTGGGAAAACTGGG - Intergenic
1060701467 9:125753758-125753780 GTGTGCTCTTTGGGGCAAGTCGG - Intronic
1185995227 X:4939806-4939828 GTAAGTTCTTTGTGAAAAATGGG - Intergenic
1186598785 X:11013589-11013611 GAGGGCTCTTTGAAAAAAATTGG + Intergenic
1186735955 X:12464168-12464190 GTGGGCTCCTGGGAAACAATGGG - Intronic
1187148507 X:16659909-16659931 GTGGGGTGTGTGGGAGAAATGGG - Intronic
1187201043 X:17134042-17134064 GTGGGTTCTTTGTGAAGATTGGG + Intronic
1187370485 X:18701649-18701671 CTAGGCTCTTTGGGAAATAGTGG + Intronic
1188461087 X:30428111-30428133 GAGGTCTCCTTTGGAAAAATGGG - Intergenic
1190220115 X:48507519-48507541 AAGTGCTCTTTTGGAAAAATAGG + Intergenic
1191265768 X:58391310-58391332 GGGAGCTCTTTGAGAACAATGGG + Intergenic
1194226974 X:91273091-91273113 GTGGTCTATTTGGGAAAAGTAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194735454 X:97507797-97507819 GTGGGCTCTGTGGGGGAATTAGG - Intronic
1195867909 X:109453236-109453258 GTAAGCTCTTTGGGAAAGAGTGG + Intronic
1196519317 X:116654661-116654683 GTGGGCTCTTTGAGAGACCTTGG + Intergenic
1197610858 X:128636684-128636706 ACAGGCTCTTTGGGAAATATAGG - Intergenic
1198227479 X:134658936-134658958 GTGGGCTCCTTGAGAGAACTGGG - Intronic
1198484541 X:137073820-137073842 GTGGCCTCTTGGAGACAAATGGG - Intergenic