ID: 1058895723

View in Genome Browser
Species Human (GRCh38)
Location 9:109399040-109399062
Sequence CAAACTGCTCCCATTGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058895720_1058895723 -6 Left 1058895720 9:109399023-109399045 CCAATCAAAAATACCACCAAACT 0: 1
1: 0
2: 0
3: 24
4: 287
Right 1058895723 9:109399040-109399062 CAAACTGCTCCCATTGATGTAGG No data
1058895715_1058895723 30 Left 1058895715 9:109398987-109399009 CCTTGGCTACACAAAGAGTATTT 0: 1
1: 0
2: 0
3: 15
4: 198
Right 1058895723 9:109399040-109399062 CAAACTGCTCCCATTGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058895723 Original CRISPR CAAACTGCTCCCATTGATGT AGG Intronic
No off target data available for this crispr