ID: 1058896940

View in Genome Browser
Species Human (GRCh38)
Location 9:109408682-109408704
Sequence AACGCAGATGCCCCCAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058896935_1058896940 27 Left 1058896935 9:109408632-109408654 CCACAGTCCATGAACTAACAGAT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1058896940 9:109408682-109408704 AACGCAGATGCCCCCAGAGAGGG No data
1058896933_1058896940 29 Left 1058896933 9:109408630-109408652 CCCCACAGTCCATGAACTAACAG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1058896940 9:109408682-109408704 AACGCAGATGCCCCCAGAGAGGG No data
1058896936_1058896940 20 Left 1058896936 9:109408639-109408661 CCATGAACTAACAGATACACTCA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1058896940 9:109408682-109408704 AACGCAGATGCCCCCAGAGAGGG No data
1058896934_1058896940 28 Left 1058896934 9:109408631-109408653 CCCACAGTCCATGAACTAACAGA 0: 1
1: 0
2: 1
3: 14
4: 145
Right 1058896940 9:109408682-109408704 AACGCAGATGCCCCCAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058896940 Original CRISPR AACGCAGATGCCCCCAGAGA GGG Intronic
No off target data available for this crispr