ID: 1058897290

View in Genome Browser
Species Human (GRCh38)
Location 9:109411390-109411412
Sequence GGGGTTAGAAATAGGGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058897290_1058897294 -10 Left 1058897290 9:109411390-109411412 CCAAGACCCCTATTTCTAACCCC 0: 1
1: 0
2: 0
3: 22
4: 200
Right 1058897294 9:109411403-109411425 TTCTAACCCCTCAGAGTCACAGG No data
1058897290_1058897295 -9 Left 1058897290 9:109411390-109411412 CCAAGACCCCTATTTCTAACCCC 0: 1
1: 0
2: 0
3: 22
4: 200
Right 1058897295 9:109411404-109411426 TCTAACCCCTCAGAGTCACAGGG No data
1058897290_1058897300 20 Left 1058897290 9:109411390-109411412 CCAAGACCCCTATTTCTAACCCC 0: 1
1: 0
2: 0
3: 22
4: 200
Right 1058897300 9:109411433-109411455 CATCCCTGCTGTCACTGTACAGG No data
1058897290_1058897303 25 Left 1058897290 9:109411390-109411412 CCAAGACCCCTATTTCTAACCCC 0: 1
1: 0
2: 0
3: 22
4: 200
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058897290 Original CRISPR GGGGTTAGAAATAGGGGTCT TGG (reversed) Intronic
900540683 1:3201166-3201188 AGGGATGGAAAAAGGGGTCTGGG + Intronic
901407915 1:9062294-9062316 GTGGTTAAAAAGAGAGGTCTGGG + Intronic
903821000 1:26102551-26102573 GGGGTAAGAGATAGGGTTGTGGG - Intergenic
907100390 1:51828247-51828269 TGGGTTAGAAATAGGTATATAGG - Intronic
910851586 1:91654646-91654668 GGGGTTGGGAATGGGGGTGTTGG - Intergenic
911921108 1:103762076-103762098 GAGGTTAGAAAGAGAGGTTTGGG + Intergenic
912860465 1:113209601-113209623 GGAGTTAGAAACAGAGGCCTTGG + Intergenic
913040996 1:115022949-115022971 GGGGTTGGATACATGGGTCTGGG + Intergenic
913972564 1:143425381-143425403 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
914066948 1:144250994-144251016 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
914112205 1:144715360-144715382 GGGGTTGGAGATAGGGGTTGGGG - Intergenic
915542634 1:156578116-156578138 GGAGTTGGAAAAAGGAGTCTTGG + Intergenic
915616607 1:157044200-157044222 ATGGTTGAAAATAGGGGTCTGGG - Intronic
921579410 1:216877839-216877861 GAGGTTAGAAGTAGTGGTCTAGG - Intronic
921735724 1:218625718-218625740 GGGGTTAGAAATGGGGGGTGGGG + Intergenic
1062941928 10:1428658-1428680 TGGGTTAGAGATTGGGGGCTGGG + Intronic
1067157426 10:43793883-43793905 GTGGTTACAAATAGTGGTTTTGG + Intergenic
1068120272 10:52777478-52777500 GGGGTTAGAAACAGGAGATTTGG + Intergenic
1068624115 10:59221957-59221979 GGAGTTAGAAATAGAGGACATGG - Intronic
1071182702 10:83005476-83005498 GGTGTTAGAAATGGGGGGCAGGG + Intergenic
1074168260 10:110905953-110905975 TGGGTTGGAAATAGAGGTCCAGG - Intronic
1076340167 10:129740136-129740158 GGAGTTAGAAGTCGGGGTCCGGG + Intronic
1076704659 10:132294477-132294499 GGGCTGAGAAATAGGGCTGTGGG + Intronic
1076935645 10:133566481-133566503 GGGGTTAGAATTAGGGTTTGGGG + Intronic
1079053706 11:17186772-17186794 GGGGATAGAAATACTGGCCTTGG + Intronic
1081543079 11:44050204-44050226 GGGGTGAGACATAGGAGCCTGGG + Intronic
1081712304 11:45225146-45225168 GGGTTTAGAAATTGGGCTTTGGG - Intronic
1082795620 11:57376353-57376375 GGGGTTAGGAGTAGGGGTGGGGG - Intergenic
1082795649 11:57376420-57376442 GGGGTTGGAAGTAGGGGTAGGGG - Intergenic
1082965783 11:58964956-58964978 TGGGTTAGAGATAAGGGCCTGGG - Intronic
1084865675 11:72054796-72054818 GGGGTTAGAGATAAGGATCTGGG + Intronic
1086283992 11:85223923-85223945 GGGGTTATAAAGAGGATTCTGGG + Intronic
1088032976 11:105274976-105274998 GGTGTTAGGAAGTGGGGTCTTGG - Intergenic
1089769260 11:120791039-120791061 GGGGGTGGAGATAGGGGTTTTGG + Intronic
1089919725 11:122197242-122197264 GGGGCCAGAAATAGGGGTTTTGG - Intergenic
1090924624 11:131238592-131238614 GGGGTGGGAAGGAGGGGTCTTGG + Intergenic
1094119455 12:26954461-26954483 GGGTTTAGAAATATATGTCTAGG - Intronic
1096352984 12:50915880-50915902 GAGGTTAGAAAGAGAGGTCTGGG - Intergenic
1097107167 12:56632626-56632648 GCGGTTAGGAAGAGGGGTGTTGG + Intronic
1099372689 12:81856852-81856874 GGAGTTTGAAATAGATGTCTTGG + Intergenic
1100757230 12:97764824-97764846 GGGCTTAGACATAGGAGTCTGGG - Intergenic
1101154654 12:101916210-101916232 GAGGTTAGAAACATGGGCCTAGG + Intronic
1102488564 12:113274829-113274851 GTGGTTAGGAACAGGGCTCTGGG - Intronic
1102638515 12:114345742-114345764 GGGGTTAGAAATAGGGTTGCAGG + Intergenic
1102680402 12:114686875-114686897 GGGGTCAGAAGTAGCGATCTGGG - Intergenic
1104331676 12:127852889-127852911 GGGGTTAGAGAAAGGAGTCAAGG - Intergenic
1105257968 13:18757355-18757377 GGGGTTGGAGATAGGGGACTTGG - Intergenic
1106255655 13:28019967-28019989 TGGGTTGGAAATAGGGATGTGGG - Intronic
1107386669 13:39917353-39917375 GGAATGAGAAATAGGTGTCTTGG + Intergenic
1109177740 13:59176727-59176749 GGGGCTAGAACTTGGGGGCTGGG + Intergenic
1109623051 13:64935131-64935153 GGTGTTAGAAATAGTGGTAGTGG - Intergenic
1114030274 14:18572799-18572821 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
1115218633 14:31037110-31037132 GAGGTTAGAAAAAGAGGACTTGG - Intronic
1115844944 14:37519236-37519258 GGGTTTAGACATAGGGATTTAGG + Intronic
1118115365 14:62770409-62770431 GTGGTAAGAAATAGTGGTTTGGG - Intronic
1120834774 14:89029782-89029804 GAAGTAAGAAATGGGGGTCTGGG - Intergenic
1121172896 14:91869235-91869257 GGGCAGAGAAATAGGGGTCGTGG - Intergenic
1122965038 14:105119504-105119526 GGGGTTATAAACAGAGCTCTCGG - Intergenic
1124817524 15:33010296-33010318 GAGGTTAGAGATGGGGGTTTGGG + Intronic
1128010501 15:64291012-64291034 GTGATTAAAAATAGGAGTCTTGG - Intronic
1128403777 15:67314154-67314176 GGGGTGAGAAGTAGGGATCAGGG - Intronic
1128958016 15:71970356-71970378 GGGTTTAGAATCAGAGGTCTTGG - Intronic
1131735280 15:95325540-95325562 GGGGTTAGACATAGGTATTTTGG - Intergenic
1132170964 15:99654493-99654515 GGTCTTAAAAATAGGGGTATTGG + Intronic
1132306839 15:100821263-100821285 GGGGTGAGAGTTAGGGGTCAGGG + Intergenic
1132744298 16:1430367-1430389 GGGGTGGGAAATGGGGGGCTGGG - Intergenic
1135344811 16:21680030-21680052 TCGATAAGAAATAGGGGTCTTGG + Intronic
1135944975 16:26857610-26857632 GGGGTTAGAAAACAGGGTCCAGG + Intergenic
1136551310 16:30984042-30984064 GGGGGAATAAATAGGGGTGTGGG - Exonic
1137226871 16:46521495-46521517 ATGGTGAGAGATAGGGGTCTAGG + Intergenic
1138249225 16:55489624-55489646 GGGGTTAGGGATACGGGTCAAGG - Intronic
1140466563 16:75187827-75187849 GAGGTTAGAAATTGTGGTTTAGG - Intergenic
1141046396 16:80719662-80719684 GGGGTTCAGAATTGGGGTCTGGG - Intronic
1141877440 16:86835647-86835669 GGGGTTTCAAATAAGGGTTTGGG - Intergenic
1143616772 17:8056141-8056163 GTGGGTTGAAATAGGGGGCTTGG + Intergenic
1144119537 17:12137437-12137459 GTGGTTGGAAATAGAAGTCTTGG + Intronic
1145956514 17:28858525-28858547 GTGGTCAGAGATAGGGGACTTGG - Intronic
1147318647 17:39633050-39633072 GGGGTTAGAGAAAGGGGCCAAGG - Intronic
1150708588 17:67510406-67510428 GCTGTTAGGAATGGGGGTCTTGG - Intronic
1151093643 17:71471070-71471092 ATGCTTAGAAATAGGGGGCTGGG - Intergenic
1151344348 17:73492611-73492633 GGGGTTGAAAATAGGGGTTTTGG - Intronic
1156147514 18:34203253-34203275 GTGGTTAGGAACAGGGGTCATGG + Intronic
1158441549 18:57479124-57479146 AGGGTCAGGGATAGGGGTCTTGG + Exonic
1161508924 19:4659832-4659854 GGGGTCAGCCATAGGGGTCCTGG - Intronic
1162560691 19:11416713-11416735 GGGCTTAGGAAGAGGGCTCTGGG + Intronic
1202647561 1_KI270706v1_random:156518-156540 GGGGTTGGAGATAGGGGTTGAGG - Intergenic
925798129 2:7568972-7568994 GGGCTTAGATTTAAGGGTCTGGG - Intergenic
928063150 2:28135506-28135528 GAGATTAGAAATGGGGATCTGGG - Intronic
929395201 2:41514509-41514531 TGGTGTAGAAACAGGGGTCTTGG - Intergenic
932612530 2:73210414-73210436 GGGGGTACAAACAGGGGTTTGGG - Intronic
934177262 2:89586348-89586370 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
934724562 2:96607398-96607420 TGGGTTTGAAATGGGGATCTAGG - Intronic
935586173 2:104801996-104802018 GGGGTTGGAATTGGGGGTCTTGG - Intergenic
935695952 2:105771221-105771243 GGGGATAGAAATAGTGATATTGG - Intronic
935838631 2:107082842-107082864 GAAGTTAGAAGTAGGGGTTTAGG + Intergenic
938497050 2:131803304-131803326 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
939945415 2:148403885-148403907 GGGGTTAGGAATGGGGGTGAGGG - Intronic
943848325 2:192680927-192680949 GGGGTCAGAGATAGGGATTTGGG - Intergenic
945814753 2:214590597-214590619 GGGGAGAGAAATAGGGCTCTGGG - Intergenic
946442883 2:219711789-219711811 GGGGTTAGCAATGGGAGTGTGGG + Intergenic
946659390 2:221983535-221983557 GTGGTTAAACATAGGGGTTTGGG - Intergenic
949055060 2:241923099-241923121 GGGTCTAGAAATGGGGGTGTGGG + Intergenic
1169495442 20:6110465-6110487 GGGGTCATATATAGGGGTCATGG + Exonic
1170860543 20:20099007-20099029 GGAGTTAGACATAGTGGACTTGG + Intronic
1172789590 20:37493663-37493685 GGAGGTAGAAATAGGGGGCATGG - Intronic
1175081671 20:56425821-56425843 TGGGTAGGAAACAGGGGTCTGGG - Intronic
1176604302 21:8816242-8816264 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
1177023025 21:15886614-15886636 TAGGTTAGGAATATGGGTCTAGG - Intergenic
1177279259 21:18958252-18958274 ATGGTGAGAGATAGGGGTCTAGG - Intergenic
1178243793 21:30932991-30933013 GTGGTGAGAGATAGAGGTCTGGG - Intergenic
1180346592 22:11707849-11707871 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
1180354359 22:11825972-11825994 GGGGTTTGAGATAGGGGTTGGGG + Intergenic
1180454387 22:15499849-15499871 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
1180914246 22:19474242-19474264 GAGATTAGAAACGGGGGTCTGGG + Intronic
1181911187 22:26239614-26239636 GGGGTTGGAGTCAGGGGTCTGGG - Intronic
1184985008 22:48125670-48125692 GGGGTTAGACATTGGGATCATGG + Intergenic
1185167708 22:49271800-49271822 GGGGTTAGGATTAGGGGTTAGGG - Intergenic
951175899 3:19599604-19599626 AGGGTGAGAGATAGGGATCTAGG - Intergenic
955990661 3:64623638-64623660 AGGTTTAGAAATAATGGTCTGGG - Intronic
956469017 3:69545660-69545682 AGGGCTTGAAATGGGGGTCTGGG - Intergenic
959269418 3:104187797-104187819 GTGGAAAGAAATAGGGGTCCAGG + Intergenic
959726536 3:109549267-109549289 GGGGCTAGAACAAGGAGTCTTGG - Intergenic
961203508 3:125062783-125062805 GGGGTTAAAAATAGGGAGATGGG - Intergenic
961884422 3:130086851-130086873 GGGGTTAGCCAGAGGGGTGTGGG - Intronic
962024115 3:131529115-131529137 GGGGTGAGAACTAGGGGGATGGG - Intergenic
964179322 3:153864979-153865001 GGGCTTAGAGACAGGGGACTAGG + Intergenic
965812470 3:172605770-172605792 GGTTTTAAAAATAGGAGTCTTGG + Intergenic
966732421 3:183162304-183162326 GGGTTTAGGAATGGGAGTCTTGG - Intronic
967408506 3:189143645-189143667 GGGATTACAAAGAGGTGTCTAGG - Intronic
968364219 3:198172964-198172986 GGGGTTAGGGTTAGGGGTGTGGG + Intergenic
968364404 3:198173579-198173601 GGGGTTAGGGTTAGGGGTGTGGG + Intergenic
969512898 4:7629740-7629762 GGGGTTTGATATATGGGGCTGGG - Intronic
969820354 4:9715432-9715454 GGGGTTAGCCAGAGGGGTGTGGG + Intergenic
970323881 4:14903106-14903128 GGGCTTGGAAATAGAGATCTGGG + Intergenic
971532978 4:27712514-27712536 GGGGTTGGAAAAAGGGGGATTGG - Intergenic
972139764 4:35943691-35943713 GGAGTTAGGATTAGAGGTCTAGG + Intergenic
973373816 4:49274707-49274729 GGGGTTGGAGATAGGGGTTGGGG - Intergenic
973383596 4:49335532-49335554 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
973387201 4:49520545-49520567 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
975393052 4:73842400-73842422 GGAGTTTGAACTAGGAGTCTTGG - Intronic
977460904 4:97323938-97323960 GGGATAAGAAATAGGACTCTAGG - Intronic
978219442 4:106253465-106253487 TGGCTTAGAAATTTGGGTCTAGG - Intronic
979514373 4:121590222-121590244 AGTGTTAGAAACAGGTGTCTTGG + Intergenic
979539635 4:121866605-121866627 GGGGTGAGAGGTGGGGGTCTTGG + Intronic
981770111 4:148299379-148299401 GGGGTTAGAAATGTCGGCCTTGG + Intronic
983916974 4:173302675-173302697 GGGGGTAGGAATAGGGGTTGAGG - Intronic
986555731 5:9008473-9008495 GGGTGTAGAAATAAGGGTTTGGG + Intergenic
988813347 5:34806595-34806617 GGGGTGAGGAAGAGGGGTCGGGG + Intronic
990515511 5:56527738-56527760 GGGGTAAGAACTAGTGATCTGGG - Intronic
990674431 5:58167754-58167776 GGGGTTAGGAATAGGCTTATAGG - Intergenic
994252041 5:97547210-97547232 GGGGTCAGAAATTTGGGGCTTGG + Intergenic
994891530 5:105641683-105641705 ATGGTAAGATATAGGGGTCTAGG - Intergenic
995174423 5:109158277-109158299 GGGGTCAGAAGTCGGGGTCGGGG + Intronic
996349102 5:122518847-122518869 GGAGTTCACAATAGGGGTCTGGG - Intergenic
996772403 5:127098968-127098990 GGACTTAGAAAAAGGGGTTTTGG - Intergenic
999961166 5:156757136-156757158 GAGGTTAAAAAAATGGGTCTAGG - Intronic
1002642877 5:180638903-180638925 GGGGTAAGAAAGAGCTGTCTTGG - Intronic
1003697489 6:8424814-8424836 GGAGTTAGAAACATGGGTTTGGG - Intronic
1004266590 6:14153378-14153400 GGAGTTAGAGATAGGACTCTAGG - Intergenic
1004499609 6:16198090-16198112 GGGGTGAGAAGTATGGGCCTAGG - Intergenic
1007389770 6:41544347-41544369 GGGGTGAGAACTAGGGGCTTTGG - Intergenic
1007722723 6:43894841-43894863 GGGGCTAGAAGGAGGGGTGTGGG + Intergenic
1009231331 6:61065390-61065412 GGAGTTAGAGTTAGGAGTCTGGG + Intergenic
1011058495 6:83234334-83234356 TGGGTTGGAGATAGGGATCTGGG - Intronic
1012937823 6:105386741-105386763 AGGGTGAGGAATAGGGGTCTTGG + Intronic
1014506371 6:122264026-122264048 GGGGATAGGAATAGAGGTCATGG + Intergenic
1015409653 6:132878713-132878735 GAGTTTAGAAATAGGGGTCATGG + Intergenic
1016027517 6:139302277-139302299 GGGATTAGAAACTTGGGTCTGGG + Intergenic
1016045374 6:139475470-139475492 GGGGTTAGAAATTGGGCTTCTGG + Intergenic
1016201301 6:141412772-141412794 TGGGTTAGAGATAGGAGTCTGGG - Intergenic
1017095585 6:150801868-150801890 GTGGTTAGAAACAGGGCTCTGGG + Intronic
1017400244 6:154053027-154053049 GGGGTTAGATATGGAGGCCTGGG - Intronic
1019809231 7:3152369-3152391 GGGGTTGAGAAAAGGGGTCTGGG + Intronic
1020035316 7:4960052-4960074 GAGGTGGGAAATGGGGGTCTTGG + Intergenic
1021993537 7:26158692-26158714 GGGTTGAGAAGTAGGGGTCATGG - Intronic
1023475120 7:40569171-40569193 GGGATGAGATATAGGGGTCAGGG + Intronic
1025997140 7:66535044-66535066 GGGTTCAGAAGGAGGGGTCTTGG + Intergenic
1026941656 7:74290620-74290642 TGGGTGAGAAGTGGGGGTCTGGG + Intronic
1028146910 7:87329104-87329126 GAGGTTAGAAAGAGAGGTTTGGG + Intergenic
1029493462 7:100884621-100884643 GGAGCTAGAAGTAGGGGGCTGGG + Intronic
1031787123 7:126046653-126046675 ATGGTGAGAGATAGGGGTCTAGG + Intergenic
1035512749 8:205482-205504 GGGGTTAGGGATAGGGGTTAGGG - Intergenic
1036795508 8:11753622-11753644 AAGGTGGGAAATAGGGGTCTGGG + Intronic
1037006103 8:13782358-13782380 GGGTTTGGAAATATGGATCTGGG - Intergenic
1038344884 8:26723299-26723321 GGGGTTAGCAGTAGGGGTAGTGG + Intergenic
1038465637 8:27760126-27760148 GGGGGTCGAAATAGGCCTCTTGG + Intronic
1041873823 8:62664939-62664961 GAGGTTGGAAATAGAGGTTTTGG - Intronic
1044847441 8:96396062-96396084 GGTGTTAGAAAGTGGGGTTTGGG + Intergenic
1047741531 8:127810587-127810609 GGGGTTAGAAATAGTGATCATGG + Intergenic
1047764934 8:127982810-127982832 GGGAGGAGAAACAGGGGTCTGGG - Intergenic
1048354390 8:133641495-133641517 GGGTTTAGAGATTGGGGCCTCGG + Intergenic
1050045520 9:1540335-1540357 TTGTTTAAAAATAGGGGTCTGGG - Intergenic
1052823803 9:33160976-33160998 GGGGATAGGGATAGGGGTATGGG - Intronic
1053095553 9:35324878-35324900 GTAGTTAGAAATATGGGTTTAGG - Intronic
1053482592 9:38426883-38426905 GGGGTCAGAAGTAGGGGTCAGGG + Intergenic
1053665430 9:40314255-40314277 GGGGTTGGAAGTAGGGGTTTGGG + Intronic
1053887899 9:42658358-42658380 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
1053914597 9:42936368-42936390 GGGGTTGGAGGTAGGGGTGTGGG + Intergenic
1053915021 9:42939302-42939324 GGGGTTGGAGGTAGGGGTTTGGG + Intergenic
1054226920 9:62465808-62465830 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
1054351174 9:64017691-64017713 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
1054376181 9:64451347-64451369 GGGGTTGGAGGTAGGGGTGTGGG + Intergenic
1054376583 9:64454285-64454307 GGGGTTGGAGGTAGGGGTTTGGG + Intergenic
1054519185 9:66062029-66062051 GGGGTTGGAAGTAGGGGTTTGGG - Intergenic
1056470768 9:86902953-86902975 GTGCATAGAAATGGGGGTCTTGG - Intergenic
1058897290 9:109411390-109411412 GGGGTTAGAAATAGGGGTCTTGG - Intronic
1061250948 9:129426063-129426085 GGGGTTAGAGCCAGGGTTCTGGG + Intergenic
1061266844 9:129511149-129511171 GGTGTTAGAAATAGGGGTAGAGG + Intergenic
1061403563 9:130381724-130381746 GGGGGTAGAAGTAGGGGTAGGGG - Intronic
1062126313 9:134864870-134864892 GGGGTTAGGAACAGGGCCCTGGG + Intergenic
1203697514 Un_GL000214v1:112680-112702 GGGGTTGGAGATAGGGGTTGGGG - Intergenic
1203551697 Un_KI270743v1:168332-168354 GGGGTTGGAGATAGGGGTTGGGG + Intergenic
1203551744 Un_KI270743v1:168529-168551 GGGGTTAGAGATCAGGGTCAGGG + Intergenic
1187072843 X:15905345-15905367 AGGCTTAGAAATAGTGGTCTTGG + Intergenic
1187172295 X:16863940-16863962 GGACTGAGAAGTAGGGGTCTAGG + Intronic
1188018268 X:25128588-25128610 GGGGTTAGAAATAGAGATCCAGG + Intergenic
1192428372 X:71096579-71096601 GGGGTTCGAAGTCGGGATCTAGG - Exonic
1194518055 X:94882910-94882932 GTTGTTAGACACAGGGGTCTAGG + Intergenic
1198632917 X:138661697-138661719 TAGGTTAGAAATAAGGGTATAGG + Intronic
1199137707 X:144272612-144272634 GGGGCCTGAAATAGAGGTCTGGG + Intergenic
1199263371 X:145801529-145801551 GGAGTTTGAGATTGGGGTCTTGG - Intergenic
1199547714 X:149024471-149024493 ATGGTTAGAGATAAGGGTCTAGG + Intergenic
1201943340 Y:19483131-19483153 GGAGGTAGAAATAGGGGGCTTGG + Intergenic