ID: 1058897291

View in Genome Browser
Species Human (GRCh38)
Location 9:109411396-109411418
Sequence CTCTGAGGGGTTAGAAATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058897291_1058897303 19 Left 1058897291 9:109411396-109411418 CCCCTATTTCTAACCCCTCAGAG 0: 1
1: 0
2: 1
3: 12
4: 168
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data
1058897291_1058897300 14 Left 1058897291 9:109411396-109411418 CCCCTATTTCTAACCCCTCAGAG 0: 1
1: 0
2: 1
3: 12
4: 168
Right 1058897300 9:109411433-109411455 CATCCCTGCTGTCACTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058897291 Original CRISPR CTCTGAGGGGTTAGAAATAG GGG (reversed) Intronic
901407142 1:9056916-9056938 GTCTCAGGGGTTAGAAGCAGGGG - Intronic
902667160 1:17947596-17947618 TGCTGATGGGTTAGAAGTAGGGG + Intergenic
904349114 1:29893579-29893601 CTCTGAAGGGCTTCAAATAGCGG - Intergenic
904391849 1:30191158-30191180 CTCTGAGGGGCTTTAAACAGAGG + Intergenic
909291091 1:73884773-73884795 ATGTGAGGTGTTAGTAATAGGGG + Intergenic
911299738 1:96157432-96157454 CTCTCAGGGGTGAGGAATACTGG - Intergenic
912860462 1:113209595-113209617 CCCCGAGGAGTTAGAAACAGAGG + Intergenic
913563120 1:120043266-120043288 TTCTCAGGAGTGAGAAATAGAGG - Intronic
913635002 1:120750324-120750346 TTCTCAGGAGTGAGAAATAGAGG + Intergenic
914283717 1:146202624-146202646 TTCTCAGGAGTGAGAAATAGAGG - Intronic
914544748 1:148653360-148653382 TTCTCAGGAGTGAGAAATAGAGG - Intronic
914621879 1:149417645-149417667 TTCTCAGGAGTGAGAAATAGAGG + Intergenic
914926904 1:151896663-151896685 CTCTGAGGGATTTTAAATGGGGG + Intronic
915324429 1:155073636-155073658 CTCTGAGGAGTTAGGGACAGAGG - Intergenic
918274927 1:182944555-182944577 CTCTGAGGAGCAAGAATTAGAGG - Intronic
918448994 1:184641246-184641268 CTCTGAGGGGTTGGCTACAGGGG - Intergenic
918761467 1:188415800-188415822 CTCTAAGGTGTTATAAAGAGTGG - Intergenic
918788157 1:188791176-188791198 CTATGAGGGGAGAGAAAAAGGGG + Intergenic
919469514 1:197961059-197961081 ATCTGAGGGACTAGAAATAGGGG + Intergenic
920079972 1:203365936-203365958 CTCTGAAGGTTTAGAGAAAGGGG - Intergenic
920853844 1:209647716-209647738 TTCTGAGTAGTTAGAGATAGGGG - Intronic
922025848 1:221747770-221747792 GTTTGTGGGGTTACAAATAGGGG - Intergenic
922865038 1:228852447-228852469 CTTTGAAGGGTGAGAAAAAGTGG - Intergenic
1063060466 10:2545859-2545881 CCCTGAAAGGTTTGAAATAGAGG - Intergenic
1073464711 10:103687687-103687709 CACTGAGGGGTTCTAAGTAGAGG - Intronic
1074012791 10:109500506-109500528 CTCTGAGGAGGCAGAAATAAGGG - Intergenic
1075531510 10:123234019-123234041 CTCTGAGGTGTCAGAATGAGTGG + Intergenic
1076350512 10:129811786-129811808 TTCTGAGGGGTGGGAAAGAGGGG + Intergenic
1077380113 11:2229471-2229493 CTCAGTGGGGTGAGAAACAGTGG - Intergenic
1078493759 11:11795543-11795565 GTCAGAGAGGATAGAAATAGTGG - Intergenic
1078526230 11:12103645-12103667 CCCGGAGGGGTGAGAAATTGGGG + Intronic
1086115227 11:83242491-83242513 CTATGAGGTGTTAGAAAAAGAGG + Intronic
1087193971 11:95286094-95286116 CCATGAGGGACTAGAAATAGGGG - Intergenic
1087321422 11:96664357-96664379 CTCTGAGGGATTACAAAAACAGG - Intergenic
1088669758 11:112129591-112129613 CTCTGAGGGGAGAGAATTACAGG + Intronic
1091594954 12:1872002-1872024 TGCTGATGGGTTAGAAATTGTGG + Intronic
1091796052 12:3297999-3298021 CTGTGAGGGCTCAGAAATGGAGG + Intergenic
1091831467 12:3553661-3553683 CTCTGAGTAGTCAGAAATACTGG - Exonic
1093204302 12:16228606-16228628 CTCAGAGGTGGTAGAAGTAGAGG - Intronic
1093357983 12:18193006-18193028 TTCTAAGGGGCTAGAAATGGAGG + Intronic
1096762034 12:53849875-53849897 GTCTGTGGTGTTGGAAATAGTGG - Intergenic
1096795654 12:54076018-54076040 CTCTTTGGGGTTAATAATAGTGG + Intergenic
1098318825 12:69219902-69219924 CACAGAGGGGTTAAAAATAAAGG - Intergenic
1098332094 12:69363709-69363731 CTCTGAAGGGTTTTAAATAGAGG - Intronic
1098884230 12:75944053-75944075 TTCTGAGGAGTTAGAAATGAAGG + Intergenic
1099746803 12:86714912-86714934 ATATGAGGAGTTAGAAAAAGAGG + Intronic
1101822200 12:108192661-108192683 CACTGAGGGGTAAGAAACAAAGG - Intronic
1101836355 12:108298569-108298591 CCCTGAGGGGCTAGGAAAAGTGG - Intronic
1103066494 12:117902590-117902612 CTCTGAGGGTTCAGGGATAGGGG + Intronic
1103358916 12:120342354-120342376 GTCTGAGGGGACAGAAACAGGGG + Exonic
1109148070 13:58807589-58807611 CTCTGAGTGCTCAGAAGTAGGGG - Intergenic
1111669961 13:91318521-91318543 CACTGAGTGTTTAGGAATAGTGG - Intergenic
1115704349 14:35983072-35983094 CACTCAGAGGTTAGAAAGAGTGG + Intergenic
1116425744 14:44788600-44788622 TTCTTAGGGGTCAGAAATAGTGG + Intergenic
1119432225 14:74575893-74575915 CTCAGAGGGGTTAGGAAGAAGGG - Intronic
1121650568 14:95554850-95554872 CTCTGAGGGGCTAGAAACTGAGG + Intergenic
1122864544 14:104597538-104597560 CACTGAGGGGTTAGAAAGTGGGG + Intronic
1128251120 15:66165064-66165086 CTGTGAGGGGTTGGTCATAGGGG - Intronic
1129452652 15:75659505-75659527 CTCGGATGGGTTAGAAAATGGGG - Exonic
1130164931 15:81445118-81445140 CTTTCAGAGGATAGAAATAGAGG + Intergenic
1133965935 16:10531803-10531825 CTCTGAGGCTCTAGAAATAGGGG + Exonic
1135591140 16:23705984-23706006 CTTTCAGGGGTTATATATAGGGG + Intronic
1137741276 16:50777975-50777997 CTCTGATGAGTTAGAAAGAAAGG - Intronic
1137863889 16:51873762-51873784 CCGTTAAGGGTTAGAAATAGGGG - Intergenic
1138322555 16:56128754-56128776 CCCTGTGGTGTTAGAATTAGAGG + Intergenic
1139514182 16:67443653-67443675 CACTGTGGGGTTGGAAAGAGAGG + Intronic
1140956145 16:79868017-79868039 CCCTTAAGGGTTGGAAATAGAGG - Intergenic
1142153788 16:88524078-88524100 GTTTGAGGGTTTAGAAATATTGG + Intronic
1143044759 17:4068827-4068849 CTCTTTGGGGTTAGAAAGGGTGG - Intronic
1143139842 17:4735426-4735448 CTCTGAGGCCTGAGAAATTGGGG + Exonic
1143545673 17:7593705-7593727 TCCTGAGAGGTTAGATATAGAGG - Intronic
1143962636 17:10733288-10733310 CTCTGAGAACTTGGAAATAGAGG + Intergenic
1147140245 17:38456557-38456579 CTCTGAGGGGCTTGGACTAGGGG + Intronic
1147630092 17:41924685-41924707 CTCTGTCGGGTTAGAGAGAGGGG - Intronic
1149417927 17:56479760-56479782 CTCTCAGGGGATGGAAAGAGAGG - Intronic
1149445323 17:56708727-56708749 CTCTGGGGGGTCAGATATATCGG + Intergenic
1149786545 17:59440375-59440397 CTCCGAGGTGTTAGAATTACAGG - Intergenic
1150336988 17:64337536-64337558 CTCTGAGGGGTAAGACATCTTGG + Intronic
1153522458 18:5965686-5965708 CTCTGATGGGTTGAAAATGGGGG - Intronic
1155110772 18:22712362-22712384 CTCTGAAGAGGTAGAATTAGAGG + Intergenic
1155349400 18:24891765-24891787 CTCTGGGGAGTCTGAAATAGGGG - Intergenic
1157901933 18:51526360-51526382 CTCCCAGGGCTGAGAAATAGTGG - Intergenic
1158007704 18:52692007-52692029 ATCTGTAGGTTTAGAAATAGAGG - Intronic
1158270767 18:55713315-55713337 TTGTCAGGGGCTAGAAATAGGGG - Intergenic
1166738191 19:45098369-45098391 CTCTGTGGGGTTGGAAAGATAGG + Intronic
1167742261 19:51330698-51330720 CTCTGTGGGGATAGCAATGGTGG + Intergenic
926978487 2:18539038-18539060 GTCAGAAGGGTTAGCAATAGAGG + Intergenic
928172819 2:29014374-29014396 CTCTGAGGGGTTGAGAACAGGGG - Exonic
928396245 2:30945173-30945195 CTGTGTAGGGTTAGAAATAAAGG + Intronic
931119714 2:59202854-59202876 CTCCAAGGTGTTGGAAATAGAGG + Intergenic
932967587 2:76495486-76495508 CACTGAGGAGCTAGAAAGAGAGG + Intergenic
935078765 2:99771627-99771649 CTCTGAGAGCTTTGAAATATTGG - Intronic
940555306 2:155218563-155218585 CTCTGAGTGATTATAAATAAGGG - Intergenic
941287253 2:163629790-163629812 GGCTGAGGGGAAAGAAATAGTGG + Intronic
942329493 2:174807039-174807061 CTCTGAGGGGTGAGATAAGGGGG + Intronic
942952800 2:181740356-181740378 ATATGAGTGGTTAGAAATATAGG - Intergenic
944344561 2:198646375-198646397 CTCTGGGGGGGTGGAATTAGGGG + Intergenic
945540777 2:211083425-211083447 TTCTGAGGGCTGGGAAATAGGGG + Intergenic
945698704 2:213142706-213142728 CTGTGAGTGGTTAAAAATATGGG - Intronic
1172786687 20:37473299-37473321 CTCTGTGGCCGTAGAAATAGTGG - Intergenic
1173760880 20:45559457-45559479 CTCTAAGGAGTAAGAAACAGTGG + Intronic
1174758284 20:53181551-53181573 CTCTGAGGAGTGAGGAGTAGGGG + Intronic
1175143547 20:56878788-56878810 CTCTATGGGCTTAGAAAGAGAGG - Intergenic
1175940838 20:62536857-62536879 CTCAGAGGGGTTGGAGTTAGAGG + Intergenic
1177757350 21:25363055-25363077 TTCTCAGGGGTTAGAGATTGTGG + Intergenic
1180137955 21:45873358-45873380 CTGTGAGGGGACAGAAATACAGG - Intronic
1180713385 22:17855284-17855306 CTCTGTAGGGTTAGGGATAGGGG - Intronic
951918283 3:27824602-27824624 TTCTGAGGTGTTAGAAGTATAGG - Intergenic
953184210 3:40623266-40623288 CTCAGAGGGATTAAAAATATTGG - Intergenic
953209619 3:40864223-40864245 CTCTGAGGGGTAAGGATTTGGGG - Intergenic
953815466 3:46152882-46152904 ATGTGAGGGGTTAATAATAGGGG + Intergenic
955448733 3:59043458-59043480 CACTGAGGGGTTTTAAACAGAGG + Intronic
956408262 3:68951123-68951145 CCCTTAGGGGTTAGAAATCATGG - Intergenic
956421459 3:69090569-69090591 CTCTCAGGTGTTGGGAATAGGGG + Intronic
959746936 3:109786521-109786543 CTTTGAGAGGTTACAAATACTGG + Intergenic
960599391 3:119440592-119440614 AACTGAGGGGTAAGAAAAAGAGG + Intronic
962928813 3:140019056-140019078 CTCTGAGTGGTTTGAAGCAGAGG - Intronic
964047241 3:152343587-152343609 ATCAAAGGGGTTAGAAATCGAGG + Intronic
965569694 3:170159369-170159391 CTCTGAGAAATTATAAATAGTGG + Intronic
967936903 3:194736110-194736132 CACTGAGGGGTAAGGAAGAGAGG - Intergenic
970186348 4:13458249-13458271 CTCTGAGGAGTTAAAAATACAGG - Intronic
971432317 4:26581136-26581158 CTCTGAAATGTCAGAAATAGAGG + Intronic
972139558 4:35940730-35940752 CTCTGTGGTCTTTGAAATAGAGG + Intergenic
973015893 4:45136281-45136303 CTCTGAGGGTTTATGAAGAGGGG + Intergenic
974234327 4:59161144-59161166 CTCAGAGGGGTCAGAAATGTAGG + Intergenic
976912920 4:90330241-90330263 CTATCAGGGATTAGAACTAGAGG + Intronic
977002106 4:91518046-91518068 CTCTGAGGGCTCTGAAATTGTGG + Intronic
978698350 4:111611070-111611092 CTCAGAGTGCTTAGACATAGGGG - Intergenic
980915802 4:139032171-139032193 CAGTGAGGGCTTAGCAATAGTGG + Intronic
981770110 4:148299373-148299395 CTCTGGGGGGTTAGAAATGTCGG + Intronic
981857550 4:149312326-149312348 CTCTGAGGGGTCAGAGATCTTGG - Intergenic
982648597 4:158056360-158056382 CTCTGAGTGGGTACAAATATTGG - Intergenic
983911143 4:173240893-173240915 CTGTGGGGGGTTAGAAACAGGGG + Intronic
986711335 5:10490027-10490049 CTCTGAGGGTTCAGAAATAGAGG + Intergenic
987409818 5:17603991-17604013 CTCTGAGGGGTGGGAAATGCAGG - Intergenic
987410464 5:17610200-17610222 CTCTGAGGGGTGGGAAATGCAGG - Intergenic
990365367 5:55065154-55065176 CTATGAGGGGCTAGAGAGAGAGG - Intergenic
995314606 5:110754101-110754123 CTCTAAGGTCTTAGAAATCGGGG + Intronic
996718553 5:126607759-126607781 CACTGAGAGGTTAGAAACATAGG - Intronic
996772404 5:127098974-127098996 ATCTGAGGACTTAGAAAAAGGGG - Intergenic
997575368 5:134971539-134971561 CTCTGTGGGGAAAGAAACAGAGG + Intronic
998190568 5:140020401-140020423 CTTTGAGGTGTTAGAAGTTGAGG - Intronic
1007908405 6:45487990-45488012 GTCTAAGGGGTAAGAAAGAGTGG + Intronic
1009796548 6:68476550-68476572 CTCTGAGGAGTTAGATAAATGGG - Intergenic
1010873151 6:81066539-81066561 CTGTGAGGGGTCAAAAACAGTGG - Intergenic
1011869620 6:91876427-91876449 CTCTAAGTGGTTAAAAAGAGTGG + Intergenic
1012426098 6:99116365-99116387 CTCTGAGGGGACAGACATAAAGG - Intergenic
1013365549 6:109434962-109434984 CTCTGAGGGTATAGATAGAGGGG + Intronic
1013455768 6:110328155-110328177 CCCTGGTGGTTTAGAAATAGAGG - Intronic
1014616038 6:123600576-123600598 ATCTGAGGGAACAGAAATAGTGG + Intronic
1016241132 6:141932145-141932167 CTTTGAGCAGTTAGAAATAGAGG - Intergenic
1016491933 6:144614794-144614816 CTATGTAGGGTTAGAAATATAGG + Intronic
1017577888 6:155825916-155825938 CACTGAGGGGTAAGAAGTGGTGG + Intergenic
1022114200 7:27248368-27248390 TTCTGAGGGGTTAGGACAAGAGG + Intergenic
1024484558 7:49903568-49903590 CCCTGAGGGGTTAAAGATGGTGG + Intronic
1024536044 7:50435166-50435188 CTCTGAGTAGTTAGAAAAACAGG - Intergenic
1034831010 7:154307429-154307451 CTCTGAGGAGGGAGAAAAAGCGG - Intronic
1037206842 8:16332190-16332212 CTCTGAAGGATTAGAAACAAGGG - Intronic
1038974195 8:32674081-32674103 CTGTACAGGGTTAGAAATAGAGG - Intronic
1040805314 8:51389567-51389589 CTCTGAGGGATCAGAAGTTGAGG - Intronic
1046199937 8:110911936-110911958 CTCTGAGGGATGAGAAAAATAGG + Intergenic
1049453158 8:142673423-142673445 CTGGGAGGGGTCAGAAAGAGAGG + Intronic
1049797642 8:144503913-144503935 CTCTGAGGGACTAGACATGGGGG - Intronic
1050432612 9:5577040-5577062 CTCTAAGGAGATAGAAATAAAGG - Intergenic
1051635665 9:19178945-19178967 CTCTGAGTAGTTAGGACTAGAGG + Intergenic
1054841004 9:69739503-69739525 GTCTTAGGGGAAAGAAATAGAGG - Intronic
1057535037 9:95893487-95893509 CTTTCAGGGTTTAGAAAAAGGGG - Intronic
1058329279 9:103739208-103739230 CTCAGAAGTGTTAGAAACAGGGG - Intergenic
1058897291 9:109411396-109411418 CTCTGAGGGGTTAGAAATAGGGG - Intronic
1059461440 9:114433155-114433177 CTGGGAGGGGTAAGAAGTAGAGG - Intronic
1059764045 9:117366550-117366572 CTCAGAGGAGTTAGAGAGAGGGG - Intronic
1061266842 9:129511143-129511165 CTCCATGGTGTTAGAAATAGGGG + Intergenic
1062054441 9:134463649-134463671 CTCTGAGGGATGAGGAAGAGAGG - Intergenic
1186293796 X:8126613-8126635 TACTGAGGGGTTAGAAAGAATGG - Intergenic
1187969662 X:24647121-24647143 CTCTGAGGGTGTAGAGCTAGAGG - Exonic
1188085522 X:25897441-25897463 ATCTGAAGGTTTAGAGATAGGGG - Intergenic
1189845424 X:45132081-45132103 CTGTTAGGGACTAGAAATAGGGG + Intergenic
1194565779 X:95486165-95486187 CTCTTAGTGGTTAGAAATGGGGG - Intergenic
1197138096 X:123086138-123086160 CTCTCAGGTGTGAGAAAAAGAGG + Intergenic
1200303772 X:155005065-155005087 CTCTGAGAGTTTAGAAGTACTGG + Intronic
1200976695 Y:9219091-9219113 CTCTGAGTGGTCAGAAACTGAGG + Intergenic
1202134476 Y:21647451-21647473 CTCTGAGTGGTCAGAAACTGAGG - Intergenic