ID: 1058897292

View in Genome Browser
Species Human (GRCh38)
Location 9:109411397-109411419
Sequence ACTCTGAGGGGTTAGAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058897292_1058897303 18 Left 1058897292 9:109411397-109411419 CCCTATTTCTAACCCCTCAGAGT 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data
1058897292_1058897300 13 Left 1058897292 9:109411397-109411419 CCCTATTTCTAACCCCTCAGAGT 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1058897300 9:109411433-109411455 CATCCCTGCTGTCACTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058897292 Original CRISPR ACTCTGAGGGGTTAGAAATA GGG (reversed) Intronic
900891268 1:5451372-5451394 ACTTTGAAGGGTGAGAAACATGG - Intergenic
902066399 1:13691817-13691839 ACTCTCAGGGGCTTAAAATATGG + Intergenic
906050017 1:42863335-42863357 ACTCTGAGGGGTGTGAACTTTGG - Intergenic
906474039 1:46155362-46155384 ACTCTGCGGAGTCAGATATATGG + Intronic
908784124 1:67718278-67718300 GGTCTGAGGAGTTAGAAAGAGGG - Intronic
908826909 1:68141930-68141952 ACTCTAAGGGGGTAGCAATGAGG - Intronic
908838590 1:68254854-68254876 AATGTGAGGGCTTAGAAATAAGG + Intergenic
909199324 1:72669774-72669796 ACTTTGAAGGGTGAGAAAAATGG + Intergenic
909291090 1:73884772-73884794 AATGTGAGGTGTTAGTAATAGGG + Intergenic
909595438 1:77401104-77401126 ATTATGAGGCTTTAGAAATATGG + Intronic
910402148 1:86847918-86847940 ATTCTGAGGTGTTGGAAATTAGG - Intergenic
912529746 1:110311770-110311792 AGTCTGAGGGTTAAGAAATCAGG - Intergenic
914444507 1:147738675-147738697 ACCCTGAAAGGTAAGAAATATGG - Intergenic
914737688 1:150434011-150434033 ACTCTGAGAAGTTAGCAATAAGG + Intronic
915087311 1:153397460-153397482 ACCCTGAGGGCTGAGAAATGGGG + Intergenic
915148118 1:153807570-153807592 ACCCTGAGGGGATAAAAACAGGG + Exonic
915832433 1:159143421-159143443 ACTCTGAGTGGCTAGTAACAAGG + Intronic
917236754 1:172901062-172901084 TCTAGGAGTGGTTAGAAATATGG - Intergenic
917499152 1:175570292-175570314 AGTTTGAGGGGTGAGAAAGATGG - Intronic
917599085 1:176557294-176557316 TTTCTGACGGGTTAGACATAGGG + Intronic
918149566 1:181786437-181786459 ACACTCTGGGGTCAGAAATAAGG - Intronic
918788156 1:188791175-188791197 ACTATGAGGGGAGAGAAAAAGGG + Intergenic
919469513 1:197961058-197961080 AATCTGAGGGACTAGAAATAGGG + Intergenic
921548454 1:216502482-216502504 CCTCTGAAAGGTGAGAAATACGG + Intergenic
1066027154 10:31370504-31370526 AGTCTGAAGAGTTGGAAATAAGG + Intronic
1066783701 10:38979440-38979462 ACTTTGAAGGGTGAGAAAAATGG - Intergenic
1066979147 10:42395860-42395882 ACTTTGAAGGGTGAGAAAAATGG + Intergenic
1068814868 10:61297869-61297891 ACTCTCTGGGAATAGAAATATGG - Intergenic
1070336294 10:75457773-75457795 ACTCTGAGGAGTGAGAAAAGAGG - Intronic
1072439196 10:95438909-95438931 GCCCTGAGGGGTTAATAATATGG - Intronic
1074012792 10:109500507-109500529 ACTCTGAGGAGGCAGAAATAAGG - Intergenic
1076242746 10:128922068-128922090 ACTCTGAGGCCTCAGAAATTTGG - Intergenic
1078526228 11:12103644-12103666 ACCCGGAGGGGTGAGAAATTGGG + Intronic
1078535794 11:12172646-12172668 ACTTTGAAGGGTGAGAAAAATGG + Intronic
1079293581 11:19211046-19211068 ACTCTGATGTTTTAGCAATAAGG - Intergenic
1080276841 11:30512557-30512579 GCCCTGAGGGGCTAGAAATGTGG - Intronic
1081481016 11:43489334-43489356 AATCTGATGGGTGAGAAATGTGG - Intronic
1081795866 11:45818983-45819005 ACTCTGAGATGTTAGGACTATGG + Intergenic
1082633335 11:55566555-55566577 ACTTTGAAGGGTGAGAAAAATGG + Intergenic
1083830449 11:65228784-65228806 AATCTGTGGCATTAGAAATAAGG - Intergenic
1084879802 11:72162920-72162942 ACTTTGAAGGGTGAGAAAAATGG + Intergenic
1086897192 11:92326805-92326827 ACTCTCAAGACTTAGAAATAGGG + Intergenic
1087127243 11:94640192-94640214 ACTTTGAAGGGTGAGAAAAATGG - Intergenic
1090355879 11:126140090-126140112 ACTTTGAGGGGTTATGAATTAGG - Intergenic
1092720489 12:11435909-11435931 ACTTTGAAGGGTGAGAAAAATGG + Intronic
1094477644 12:30853697-30853719 GCCCTGCGGGGTCAGAAATAGGG - Intergenic
1095618628 12:44222753-44222775 GCTCTGAGATGTTAGAAATTAGG + Intronic
1095839143 12:46672927-46672949 AATCTATGGTGTTAGAAATAAGG - Intergenic
1096772098 12:53941851-53941873 TCTCTGAGTGGGTAGAAAGATGG - Intronic
1098992607 12:77080673-77080695 ACTTTGTGGGGTTAAAAAGAAGG + Intergenic
1099373364 12:81865837-81865859 ACTGAGAAGGGTTAGAAATGGGG - Intergenic
1099729693 12:86484630-86484652 ACTGAGAGGGGTGAGAAATGTGG + Intronic
1099869637 12:88330673-88330695 TCTCTGAGATGTTAGAGATAAGG + Intergenic
1100271581 12:93030093-93030115 ACTTTGAAGGGTGAGAAAAATGG - Intergenic
1107104000 13:36624121-36624143 ACTTTGAAGGGTGAGAAAAATGG - Intergenic
1107984107 13:45760203-45760225 TCTCTGAAGGGTTAAAACTAGGG - Intergenic
1108000313 13:45900240-45900262 ACTTTGAAGGGTGAGAAAAATGG + Intergenic
1108688393 13:52840555-52840577 TCATTGAGGGGTAAGAAATAGGG + Intergenic
1112605754 13:100904297-100904319 ACTTTGAAGGGTGAGAAAAATGG + Intergenic
1114799849 14:25761155-25761177 ACTCTGTGGGCATAGAAACAAGG - Intergenic
1116972105 14:51076842-51076864 CAACTGAGGGGTTAGGAATAAGG - Intronic
1117251622 14:53945776-53945798 ATTCAGAGTGGTTAGAAATGTGG - Intergenic
1117565869 14:56992675-56992697 ACTTTGAAGGGTGAGAAAAATGG - Intergenic
1118489802 14:66247905-66247927 ACTCTCAGGGATTATAAATGGGG - Intergenic
1118828738 14:69408721-69408743 ATTCAGAGGGCTTAGAAATCAGG - Intronic
1119128755 14:72152858-72152880 ACTTTGAAGGGTGAGAAAAATGG + Intronic
1119377834 14:74209042-74209064 ACCCAGAGAGCTTAGAAATATGG + Intergenic
1119432226 14:74575894-74575916 GCTCAGAGGGGTTAGGAAGAAGG - Intronic
1120009947 14:79402374-79402396 CCTCTCAGGAGTTAGAAAGATGG - Intronic
1122864543 14:104597537-104597559 CCACTGAGGGGTTAGAAAGTGGG + Intronic
1123827399 15:24096137-24096159 ACTCTGCGGTGTTAGGAACAGGG + Intergenic
1124798643 15:32807777-32807799 ACTCTGAGGGTTTAGGGAAAAGG + Intronic
1126151834 15:45530276-45530298 ACTCCGAGTGCGTAGAAATAAGG - Intergenic
1128553908 15:68617061-68617083 GCTCTGAGGGGTCAAAAAAATGG + Intronic
1130067831 15:80619718-80619740 GCTGTGAGCAGTTAGAAATATGG - Intergenic
1131817175 15:96233855-96233877 ACTTTGAAGGGTTAGAAAAACGG - Intergenic
1133965934 16:10531802-10531824 CCTCTGAGGCTCTAGAAATAGGG + Exonic
1134427290 16:14162686-14162708 ACTCTGTGGCGTTAGAAATCAGG + Intronic
1137936899 16:52643372-52643394 ACTCTGAAGGGCTAGAAAATAGG - Intergenic
1138174544 16:54884661-54884683 ACTTTGAAGGGTGAGAAAAATGG - Intergenic
1138475538 16:57268822-57268844 ACCCTGAGGGGTTAAGAACATGG + Intronic
1139296483 16:65906043-65906065 AATCTGAGTGGCTTGAAATAAGG - Intergenic
1140178669 16:72691765-72691787 ACTCAGAGAGCTTAGATATATGG + Intergenic
1141234150 16:82199915-82199937 ACTCTGGGAGGTCAGAAATTGGG - Intergenic
1141539714 16:84710421-84710443 ACTTTGAGGGGAAAGAAGTAGGG + Intronic
1150817040 17:68400590-68400612 ACCCTGAGGGGTTGGAACTCAGG + Intronic
1153130499 18:1850859-1850881 TCTCTGAGGTGTTAGATCTATGG - Intergenic
1155133327 18:22961404-22961426 ACTCTGGGGTGTAAGAAGTATGG - Intronic
1155797614 18:30059822-30059844 ACTTTGAAGGGTGAGAAAAACGG + Intergenic
1156195196 18:34767238-34767260 ACTCTGAGAGGGTAGACATGTGG - Intronic
1156544843 18:37954354-37954376 ACACTAAGGGGTGGGAAATAAGG - Intergenic
1158270768 18:55713316-55713338 ATTGTCAGGGGCTAGAAATAGGG - Intergenic
1158974929 18:62702844-62702866 ACTCTGAGGGGTTTGCCAAATGG + Intergenic
1165473372 19:36015900-36015922 GCTCTGAGGGGTTGGGGATAGGG + Exonic
1166939665 19:46355159-46355181 ACTCTGAGGTGGGAGAGATAAGG - Intronic
1166992706 19:46702345-46702367 ACTCTGAAGCCTTAGAAATACGG - Intronic
925995578 2:9290029-9290051 GCTCTCAGGGGTTATGAATAGGG + Intronic
928225344 2:29443590-29443612 ACCCTAAGGGGTGAGAAATTGGG - Intronic
928437372 2:31263593-31263615 GCTCTGAGGGGTGGGAGATAGGG + Intronic
929063298 2:37945741-37945763 ACTCTGAGGTTTTAGACACAAGG + Intronic
929730441 2:44485834-44485856 AATCTGTGGTGTTAGAAATCAGG + Intronic
933945745 2:87284710-87284732 ATTCTGCGGGGTTAAAAATCAGG - Intergenic
935055829 2:99565908-99565930 ACCATTAGGGGTTAGAAAGAGGG - Intronic
936334468 2:111576876-111576898 ATTCTGCGGGGTTAAAAATCAGG + Intergenic
939735350 2:145837304-145837326 ACTGTGAGGGGACAGAAAGAAGG + Intergenic
940275914 2:151940480-151940502 GCCATGAGGGGTCAGAAATATGG - Intronic
940324290 2:152409254-152409276 GCTGTGAGGGATTAGAAAAATGG + Intronic
940555307 2:155218564-155218586 ACTCTGAGTGATTATAAATAAGG - Intergenic
944474647 2:200091219-200091241 ACTCAGAGGAGTCAGAAAAATGG + Intergenic
945677146 2:212869161-212869183 GCTGTGAAGGGTGAGAAATAGGG + Intergenic
945698705 2:213142707-213142729 ACTGTGAGTGGTTAAAAATATGG - Intronic
1180690526 22:17711039-17711061 ACTTTGAGCTGTTAAAAATAAGG + Intronic
1180741905 22:18059314-18059336 CCTCTGAGAGGTTTTAAATAGGG + Intergenic
1183038079 22:35155250-35155272 ACTTTGAGGGGTGAGGAAAATGG + Intergenic
949862163 3:8515747-8515769 ATTCTGAGGGGTTAGAAAGAAGG + Intronic
952549882 3:34464786-34464808 ACTCTGAGGAGTTTGGAAAAAGG - Intergenic
952581901 3:34843875-34843897 GATGTGAAGGGTTAGAAATAAGG + Intergenic
953815465 3:46152881-46152903 AATGTGAGGGGTTAATAATAGGG + Intergenic
956578382 3:70781450-70781472 ACACTGTGGGGTCAGAAAGATGG + Intergenic
957583011 3:82100448-82100470 ATTCTGTGGGGTTAGAATTTAGG + Intergenic
957619825 3:82581378-82581400 ACTTTGAAGGGTGAGAAAAATGG + Intergenic
958557892 3:95703785-95703807 GATCTGATGGGTTAAAAATATGG - Intergenic
958565955 3:95810582-95810604 ACACTGAGTGGTAAGAAATCAGG - Intergenic
958743830 3:98109581-98109603 ACTTTGAAGGGTGAGAAAAATGG - Intergenic
959387714 3:105732822-105732844 ACTGAGAGGGCTTAGAAATAGGG + Intronic
959417520 3:106094510-106094532 ACTCTGAGGTGTGGGAAATGTGG + Intergenic
960696656 3:120402916-120402938 ACTCTGTTGGGCCAGAAATACGG + Exonic
961203510 3:125062790-125062812 CTTCTGGGGGGTTAAAAATAGGG - Intergenic
962204084 3:133420964-133420986 ACTCTTAGGGGTTAGTAACAGGG - Intronic
963250952 3:143103070-143103092 ACTATGAGGGGAGAGAAAGAGGG - Intergenic
964048237 3:152357829-152357851 GCTGTGAAGAGTTAGAAATAAGG + Intronic
964073077 3:152659004-152659026 ACTTTGAAGGGTGAGAAAAATGG + Intergenic
965532942 3:169793055-169793077 ACTCTGTGGGGTTAGAAGTCAGG + Intergenic
969463102 4:7339182-7339204 ACACGGAGGGGTGAGAAAAAGGG - Intronic
969517761 4:7657046-7657068 TATCTGAGTTGTTAGAAATACGG + Intronic
970419678 4:15893673-15893695 ACTCTGTGGTGTTAGAAACCAGG - Intergenic
970829380 4:20318863-20318885 ACTCTGGGGACTTAGAACTAAGG + Intronic
974215280 4:58838541-58838563 ACTCTAAGTGGTTAGAGAAATGG - Intergenic
974811190 4:66948261-66948283 ACTCTGAGAGCTTAGAAAATAGG - Intergenic
975683997 4:76901864-76901886 ACCCTGGGGGGTTAGAAACAGGG + Intergenic
975782669 4:77856340-77856362 ACTGTGAGTGGTTAAAAATAGGG + Intergenic
977958864 4:103061894-103061916 TCTGTGAGGGTTTAGAAAAAGGG - Intronic
978698351 4:111611071-111611093 ACTCAGAGTGCTTAGACATAGGG - Intergenic
981113280 4:140959716-140959738 ACTCTGAGGGAGTTGAAACAAGG - Intronic
982594513 4:157362300-157362322 ACTTTGAGGGATTGGAAATGTGG + Intronic
983041439 4:162932498-162932520 ACAATGTGGGGTTAAAAATAAGG - Intergenic
983911142 4:173240892-173240914 TCTGTGGGGGGTTAGAAACAGGG + Intronic
986135751 5:4975887-4975909 ACTGGGAGGGGTTAGATTTAGGG - Intergenic
986213884 5:5699609-5699631 ACTTTGAAGGGTGAGAAAAATGG - Intergenic
986424202 5:7614287-7614309 ACTCAGAGGGGATAGAGAGATGG - Intronic
986763087 5:10897736-10897758 AATCTGAGTGGGTAGAAGTAAGG + Intergenic
989794678 5:45452629-45452651 ACTTTGAGGGTCTAGACATAGGG - Intronic
990181333 5:53163676-53163698 ATTTTGAGTGGTTAGAAACAGGG + Intergenic
990374439 5:55155242-55155264 ACCCAGAGGGGTTAAAAATAAGG + Intronic
993263459 5:85691787-85691809 ACACTGATAGGTTAGAAATGGGG - Intergenic
995515408 5:112950087-112950109 ATTCTGAGGGGAGAGAAAGAAGG - Intergenic
995648074 5:114335777-114335799 AGTAAGAGTGGTTAGAAATATGG + Intergenic
996772405 5:127098975-127098997 AATCTGAGGACTTAGAAAAAGGG - Intergenic
997082724 5:130759402-130759424 ACTTTGAAGGGTGAGAAAAATGG - Intergenic
997376936 5:133403982-133404004 ACTCTGAGGGGTCAGTGTTAAGG + Intronic
998570535 5:143252947-143252969 AATCTAAGGTGTTAGAAATTAGG - Intergenic
1000428458 5:161120531-161120553 ACACTGAAGGGTTTGAAACAGGG - Intergenic
1001858988 5:175036796-175036818 ACCCTGAGGGTTTCTAAATAGGG + Intergenic
1003668862 6:8136890-8136912 ACTCTCTGGGGTTAGACATAGGG - Intergenic
1004900484 6:20188979-20189001 ACTCTGAGGGAATATAAAGAAGG - Intronic
1005607948 6:27494113-27494135 AATCTGTGGTGTTAGAAATCAGG - Intergenic
1006711482 6:36076234-36076256 ACATTGAGGGGTTAAAATTATGG - Intronic
1009796549 6:68476551-68476573 ACTCTGAGGAGTTAGATAAATGG - Intergenic
1010391525 6:75343513-75343535 TCTCTGAGAGGATAGAAACAAGG - Intronic
1012175138 6:96072290-96072312 GCTCTGACTGCTTAGAAATAAGG - Intronic
1012259260 6:97068695-97068717 ACTCTAAGGTTTTACAAATAAGG + Intronic
1012366016 6:98441633-98441655 AATATGAGGTGTTAAAAATAAGG + Intergenic
1013455453 6:110325702-110325724 ACTTTGAAGGGTGAGAAAAATGG + Intronic
1014747636 6:125218868-125218890 ACTTTGAAGGGTGAGAAAAATGG + Intronic
1016045371 6:139475463-139475485 CCCCAGAGGGGTTAGAAATTGGG + Intergenic
1016234588 6:141848081-141848103 ACTCTGAGGTGTGTAAAATAAGG + Intergenic
1016353296 6:143191192-143191214 ACTCTAATGGGTTAGTTATAGGG + Intronic
1017533192 6:155317960-155317982 ATTCTGTGGGGATAGAAGTAGGG + Intergenic
1017549770 6:155493465-155493487 ACTCAGAGGGGTTGGAATCAGGG + Intergenic
1018624162 6:165761185-165761207 ACTTTGAAGGGTTAGAAAAATGG - Intronic
1020409435 7:7874767-7874789 ATTCTGTGTTGTTAGAAATAAGG + Intronic
1021493556 7:21246989-21247011 ACTTTGAGGAGCAAGAAATAAGG - Intergenic
1023867205 7:44243980-44244002 TCTCTGAGGAGTGAGAAACAGGG - Intronic
1024035272 7:45502893-45502915 ACTTTGACGGGTGAGAAAAATGG + Intergenic
1024453394 7:49575614-49575636 ACTTTGAGGTGATAGAAACATGG + Intergenic
1026523379 7:71134625-71134647 TCTCTCAGGTGTCAGAAATATGG + Intronic
1027662622 7:81005552-81005574 ACTTTGAAGGGTGAGAAACATGG - Intergenic
1030020567 7:105271394-105271416 AATCTGAAGGTTTAGAGATAAGG - Intronic
1031020997 7:116627212-116627234 ACTTTGAAGGGTGAGAAAAATGG - Intergenic
1031557669 7:123198421-123198443 AATTTGAGGGCTTAGAAATTTGG + Intronic
1033753822 7:144380757-144380779 ACTCTCAGGGGTCAGAAAGCAGG - Intergenic
1036814543 8:11891765-11891787 AATCTGAGGGTTTAGTAACAAGG - Intergenic
1037006105 8:13782365-13782387 AATCAGAGGGTTTGGAAATATGG - Intergenic
1037206843 8:16332191-16332213 GCTCTGAAGGATTAGAAACAAGG - Intronic
1040664377 8:49615319-49615341 ACTTTAAGGGGTGAGAAAAATGG + Intergenic
1045832749 8:106483736-106483758 ACTCTGTGGGCTTGGAAATTTGG - Intronic
1047588693 8:126302942-126302964 ACTTTGAAGGGTGAGAAAAATGG - Intergenic
1048742722 8:137580045-137580067 ACTTTGAAGGGTGAGAAAAATGG + Intergenic
1051494223 9:17700796-17700818 ACTCTGAGGACTTAAACATATGG + Intronic
1053261313 9:36667530-36667552 ACTCTGAAGGTTTTGCAATATGG + Intronic
1058261726 9:102841556-102841578 ACTCAGGAGGGTTAGAAGTAGGG - Intergenic
1058897292 9:109411397-109411419 ACTCTGAGGGGTTAGAAATAGGG - Intronic
1061266841 9:129511142-129511164 ACTCCATGGTGTTAGAAATAGGG + Intergenic
1187400291 X:18953678-18953700 ACACTTTGGGGTTAGAAATGTGG + Intronic
1188012361 X:25070978-25071000 AATCTGTGGTGTTAGAAATCGGG - Intergenic
1188293790 X:28420063-28420085 ACTCAGTTGGGGTAGAAATAGGG - Intergenic
1189845423 X:45132080-45132102 ACTGTTAGGGACTAGAAATAGGG + Intergenic
1194565780 X:95486166-95486188 CCTCTTAGTGGTTAGAAATGGGG - Intergenic
1194945310 X:100059674-100059696 ACCCTGAGGGGTTAGATTTTGGG - Intergenic
1195662212 X:107390408-107390430 ACTCTGTGGTGTTAGAAGTTAGG - Intergenic
1195772354 X:108364925-108364947 AGTCTGGGTGGCTAGAAATAAGG - Intronic
1195944729 X:110197602-110197624 ATTAAGAGGGGTTAGAAAAAAGG - Exonic
1196966833 X:121065367-121065389 ATTTTGAGGGGTTAGCAAAATGG - Intergenic
1197026671 X:121758889-121758911 ACTCTGCAGGATAAGAAATAAGG - Intergenic
1197057446 X:122137689-122137711 ACGCTGAGGGGTGAGAGAAATGG - Intergenic
1197837054 X:130705926-130705948 ACTTTGAAGGGTGAGAAAAATGG - Intronic
1198772954 X:140150320-140150342 ACTTTAAGGGGTTAGACATCAGG + Intergenic
1201257489 Y:12123457-12123479 ACTCTCATGGATCAGAAATATGG + Intergenic