ID: 1058897293

View in Genome Browser
Species Human (GRCh38)
Location 9:109411398-109411420
Sequence GACTCTGAGGGGTTAGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058897293_1058897303 17 Left 1058897293 9:109411398-109411420 CCTATTTCTAACCCCTCAGAGTC 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data
1058897293_1058897300 12 Left 1058897293 9:109411398-109411420 CCTATTTCTAACCCCTCAGAGTC 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1058897300 9:109411433-109411455 CATCCCTGCTGTCACTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058897293 Original CRISPR GACTCTGAGGGGTTAGAAAT AGG (reversed) Intronic
901378209 1:8854841-8854863 GATTCTGAGGGATTGGAAAATGG - Intergenic
902284206 1:15395901-15395923 GTCTCTGATGGCTTAGAACTGGG - Intronic
904237980 1:29126051-29126073 GACTCTGAGGGGGCAGGACTAGG + Intergenic
904452551 1:30623797-30623819 TACTGAGAGGGGTTACAAATGGG - Intergenic
905572603 1:39017551-39017573 GGATCTGAGGATTTAGAAATGGG + Intergenic
905760356 1:40551451-40551473 GAGCTGGAGGGGTTAGAAATGGG - Intergenic
906674691 1:47684835-47684857 GACTCTGAGGGTCTAGAACTAGG + Intergenic
907072455 1:51549035-51549057 GACTCTCAGGCTGTAGAAATTGG + Intergenic
911901956 1:103517627-103517649 GACTCAGAGGGGTTAGAGGCAGG + Intergenic
915087310 1:153397459-153397481 GACCCTGAGGGCTGAGAAATGGG + Intergenic
915148117 1:153807569-153807591 GACCCTGAGGGGATAAAAACAGG + Exonic
915439802 1:155938734-155938756 GCCTCATAGGGGCTAGAAATGGG - Intergenic
919469512 1:197961057-197961079 GAATCTGAGGGACTAGAAATAGG + Intergenic
919568313 1:199217308-199217330 GACTCTCAGGGATTAGAGACTGG - Intergenic
920499511 1:206477415-206477437 GACTCTGAAGGGAAAGAAAGAGG + Intronic
922054488 1:222027532-222027554 GAATGTGAGAGGTTAGAAAATGG - Intergenic
1063228353 10:4038281-4038303 GGCTCTGAGGGGATTGAAAAAGG + Intergenic
1065051825 10:21800355-21800377 GCCTCTGAGGGCTCTGAAATTGG - Intronic
1070584253 10:77749452-77749474 GACTGTGAAAGGTAAGAAATAGG + Intergenic
1075351747 10:121730666-121730688 GACTCTGAGGGGTCAGATGAGGG - Intergenic
1077262645 11:1631015-1631037 GATGCTGAGGGGAGAGAAATGGG - Intergenic
1078526227 11:12103643-12103665 TACCCGGAGGGGTGAGAAATTGG + Intronic
1079846399 11:25475620-25475642 GACTTTCAGGTGTAAGAAATAGG + Intergenic
1080273024 11:30470873-30470895 GAATCTTAGAGGTTAAAAATTGG - Intronic
1082287320 11:50331557-50331579 GGCTCTGAGGGAATAGAAACGGG + Intergenic
1088185509 11:107163186-107163208 GACACAGAGGGGTTACAAAATGG + Intergenic
1089654785 11:119939365-119939387 GACAGTGAGGGGTTAGGAGTAGG + Intergenic
1090129305 11:124123178-124123200 GAATCTGAGGGGTTAAATAAGGG + Intronic
1091073054 11:132587208-132587230 GATTCTGAGGGGTTTGCAAAAGG + Intronic
1094477645 12:30853698-30853720 GGCCCTGCGGGGTCAGAAATAGG - Intergenic
1096574372 12:52543493-52543515 GCCTCTGAGCGGTGAGAAAAGGG + Intergenic
1097160198 12:57040830-57040852 GACTCTGAGATGTTAGAGAAGGG + Intronic
1098244396 12:68501334-68501356 GACTATAAGTGGTTAAAAATAGG - Intergenic
1099373365 12:81865838-81865860 CACTGAGAAGGGTTAGAAATGGG - Intergenic
1101643400 12:106605578-106605600 GACTCTGAGGGTTCAGACAATGG - Intronic
1103393251 12:120589275-120589297 GACCCTGGGGGGCTGGAAATAGG + Intergenic
1110335325 13:74323377-74323399 GTCTCTGGCGGGTTAGGAATTGG + Intergenic
1110667024 13:78128764-78128786 GATTTTAAGAGGTTAGAAATAGG - Intergenic
1115083829 14:29489694-29489716 GACTTTTAGTGGTTAGATATAGG + Intergenic
1118489803 14:66247906-66247928 AACTCTCAGGGATTATAAATGGG - Intergenic
1118677466 14:68202999-68203021 GACTCTGAGGGGTTTAAGACTGG - Intronic
1122076679 14:99239645-99239667 GATGCTGAGGGGATAGAAAAAGG - Intronic
1122864541 14:104597536-104597558 TCCACTGAGGGGTTAGAAAGTGG + Intronic
1126987855 15:54334822-54334844 GACACTGAGGAGTGAGGAATGGG + Intronic
1127712184 15:61610441-61610463 TAGACTGAGGAGTTAGAAATTGG + Intergenic
1128922652 15:71625922-71625944 GACTCTGCAGGATTAGAAATGGG + Intronic
1131816276 15:96224271-96224293 GACTTAGAGGGGTTAGAGATGGG + Intergenic
1132091776 15:98953228-98953250 GACACTGAGGGGTGAGAATCTGG - Intronic
1133552402 16:6869633-6869655 AACTCTGACGTGTTAGAACTAGG + Intronic
1133665467 16:7963419-7963441 GCCTCTGAAGGCTTTGAAATGGG - Intergenic
1138235814 16:55381472-55381494 GCCTCTGAAGGGTTCGAAAAAGG + Intergenic
1138774537 16:59705686-59705708 GACGCTGAGGAGTCAGAAAGAGG + Intergenic
1141234151 16:82199916-82199938 AACTCTGGGAGGTCAGAAATTGG - Intergenic
1147461780 17:40576929-40576951 GACTCTAAGAGGTTATACATTGG + Intergenic
1148596970 17:48864501-48864523 GTCCCTGAGGGGATAGAAAATGG - Intronic
1149552045 17:57547519-57547541 GATTCTGATGGATTGGAAATGGG + Intronic
1150371250 17:64640371-64640393 GACTCTGAGGTGGAAGAGATTGG + Intronic
1153522460 18:5965688-5965710 GTCTCTGATGGGTTGAAAATGGG - Intronic
1158667662 18:59447592-59447614 GGCTCTGAGTTGTTAGAATTGGG + Intronic
1159372601 18:67547615-67547637 GATTCTGAGGGGTTAGATAAGGG - Intergenic
1159462980 18:68743531-68743553 GACCCTGAGGAGTTAGCACTGGG + Intronic
1162227212 19:9233040-9233062 GACTCAGAGAGCTTAGTAATTGG - Intergenic
1167811900 19:51840536-51840558 GACCTTGAGGGGTAAGAACTGGG + Intergenic
927834405 2:26381572-26381594 AGCTCTGAGGTGTTGGAAATAGG - Intronic
928225345 2:29443591-29443613 CACCCTAAGGGGTGAGAAATTGG - Intronic
928453447 2:31398858-31398880 GACTCAGAGGGCTTGGAAACTGG - Intronic
931046755 2:58362638-58362660 GAATCTCAGGTGTTAGAATTAGG - Intergenic
931753727 2:65353145-65353167 GCCTCAGAGGGGGTATAAATAGG + Intronic
932025831 2:68131395-68131417 GATTCTGAGGGAATAGAAATGGG - Exonic
933641098 2:84761311-84761333 GACTCAGAGGGGTGAGAAGGTGG + Intronic
936699559 2:114994576-114994598 GACTCTGAGGGACAGGAAATTGG - Intronic
937776722 2:125786460-125786482 GACTCTGAGGAGTCTTAAATAGG + Intergenic
938753529 2:134358562-134358584 GACTGTGAGGGCTAAGGAATGGG + Intronic
939290492 2:140188237-140188259 GAAGCTGAGGAGTTAGAAAAAGG - Intergenic
940142585 2:150509683-150509705 GACTCTGAGATGTAAGAAAAAGG - Intronic
943475859 2:188354194-188354216 GACTCTGAGATGGTAAAAATTGG - Intronic
945677145 2:212869160-212869182 GGCTGTGAAGGGTGAGAAATAGG + Intergenic
946504859 2:220287881-220287903 GACTCTGAGGGATTTTAAACAGG + Intergenic
947166999 2:227272948-227272970 GGCTCTGAGTGGTGAGAAAGGGG + Exonic
947783647 2:232794163-232794185 CACACTGAGAGGTTAGAAATAGG + Intronic
948088600 2:235271505-235271527 CAATCTGATGGGTGAGAAATGGG - Intergenic
948830707 2:240597098-240597120 GCCTCTGAGAGGTTGGAGATGGG - Intronic
1168745141 20:233070-233092 GGCTCTCAGGGCTTAGAAAAAGG - Intergenic
1170419305 20:16176643-16176665 GATTCTGAGGGGCAAGAATTTGG - Intergenic
1174220448 20:48950162-48950184 CTCTCTGAGAGGTTACAAATTGG - Intronic
1174926814 20:54769343-54769365 GATTCTGAGGGACCAGAAATTGG - Intergenic
1180741903 22:18059313-18059335 GCCTCTGAGAGGTTTTAAATAGG + Intergenic
1182725449 22:32441724-32441746 AACTCTGCAGGTTTAGAAATGGG + Intronic
949682692 3:6533593-6533615 GACTCCAAGTTGTTAGAAATTGG - Intergenic
949770520 3:7572280-7572302 ATCTCTGAGGGGCAAGAAATAGG - Intronic
950630553 3:14279110-14279132 GACTCTGAGGGGCGAGGAGTGGG + Intergenic
953209622 3:40864225-40864247 GCCTCTGAGGGGTAAGGATTTGG - Intergenic
957687773 3:83525031-83525053 GACACTGAGGAGTTAGCAACAGG + Intergenic
959387713 3:105732821-105732843 GACTGAGAGGGCTTAGAAATAGG + Intronic
962204085 3:133420965-133420987 GACTCTTAGGGGTTAGTAACAGG - Intronic
962346938 3:134625383-134625405 GACTCTGAGAAGTCAGAAGTAGG + Intronic
966387949 3:179421746-179421768 TATTCTGAGTGGTTATAAATAGG - Intronic
967796202 3:193601454-193601476 GACCCTCAGGGGTTGGAAAAGGG + Intronic
967869332 3:194217128-194217150 GACTTTCAGGGGATAGGAATGGG + Intergenic
971062510 4:22988545-22988567 GTCTCTAAGTGGTTAGAAACTGG - Intergenic
973621315 4:52728847-52728869 GAATATGCGGGGTTAGAAAGGGG - Intronic
974247104 4:59333900-59333922 AACACTGAGGGGCTAGAATTTGG - Intergenic
975683996 4:76901863-76901885 TACCCTGGGGGGTTAGAAACAGG + Intergenic
975782668 4:77856339-77856361 AACTGTGAGTGGTTAAAAATAGG + Intergenic
977740701 4:100477864-100477886 GACTCTGAGGGGCTTAAATTTGG - Intronic
977960464 4:103079080-103079102 GACTCTGGGGTGATACAAATAGG - Intronic
978542232 4:109830308-109830330 GTCACTGAAGGGTTTGAAATGGG + Intronic
990089506 5:52024465-52024487 GACTCTGAGGCCTTTGAACTTGG - Intronic
993263460 5:85691788-85691810 CACACTGATAGGTTAGAAATGGG - Intergenic
993850282 5:92999773-92999795 GACACTGAGGGGGCAGAAAAGGG - Intergenic
996605778 5:125319783-125319805 AAATCTGTGGTGTTAGAAATTGG - Intergenic
997754727 5:136385728-136385750 GACTCAAAGAAGTTAGAAATGGG - Intronic
999106380 5:149074932-149074954 GATTCTGAGGGGTGAGGTATGGG - Intergenic
1000428459 5:161120532-161120554 GACACTGAAGGGTTTGAAACAGG - Intergenic
1001858987 5:175036795-175036817 GACCCTGAGGGTTTCTAAATAGG + Intergenic
1002005170 5:176226747-176226769 CACTCTGAGGGGGAAGAAACTGG + Intergenic
1002221205 5:177683878-177683900 CACTCTGAGGGGGAAGAAACTGG - Intergenic
1002425246 5:179171161-179171183 GTCTGTGATGGGTTTGAAATAGG + Intronic
1003668863 6:8136891-8136913 AACTCTCTGGGGTTAGACATAGG - Intergenic
1004961757 6:20798182-20798204 GATTTTTAGGGGTTAGAGATTGG + Intronic
1006677850 6:35776886-35776908 GCCTCAGAGGGGAGAGAAATTGG + Intronic
1012089791 6:94876398-94876420 CACTCTTAGAGGTTGGAAATAGG + Intergenic
1012244134 6:96907620-96907642 GCCTCTTAGGGGTAAGAAACTGG - Intergenic
1013545281 6:111150741-111150763 GACACTGAGGGGGTGGAAACAGG + Intronic
1013781106 6:113729536-113729558 GAGTCTGAGGTGTGAGAACTTGG - Intergenic
1016045369 6:139475462-139475484 ACCCCAGAGGGGTTAGAAATTGG + Intergenic
1017549769 6:155493464-155493486 GACTCAGAGGGGTTGGAATCAGG + Intergenic
1022906723 7:34865083-34865105 GACTCTCAGGGCTTAGAAGAGGG + Intronic
1023129362 7:36987190-36987212 GAGTCTGAGGGGATGAAAATGGG - Intronic
1023501067 7:40849910-40849932 GACTCAGAGGCATGAGAAATTGG + Intronic
1023643864 7:42288920-42288942 GAATCTTTGGGGTTGGAAATGGG + Intergenic
1023867206 7:44243981-44244003 GTCTCTGAGGAGTGAGAAACAGG - Intronic
1024863856 7:53880482-53880504 GACTCTCAGGGAGTAGAAGTGGG + Intergenic
1026437750 7:70414605-70414627 GACTCTCAGAGGTGAGAAAGAGG + Intronic
1027642197 7:80750102-80750124 GACTCAAAAGGATTAGAAATAGG + Intronic
1029520560 7:101058897-101058919 GAGTCTGGGAGGTTAGAAACAGG - Intergenic
1030363209 7:108617200-108617222 GACTATGATGATTTAGAAATTGG - Intergenic
1031294918 7:119989557-119989579 GACTCTGAGGGGTGAAAAGAAGG + Intergenic
1031433072 7:121696993-121697015 GACTCTGAGGCCTTAGGAAATGG - Intergenic
1033555599 7:142486265-142486287 GACTCTCATGGGCCAGAAATTGG + Intergenic
1033557989 7:142505755-142505777 GACTCTCATGGGCCAGAAATTGG + Intergenic
1033560445 7:142525793-142525815 GACTCTCATGGGCCAGAAATTGG + Intergenic
1034139790 7:148804753-148804775 GAATCTGAAGGGTAAGAAAGTGG + Intergenic
1035634187 8:1131197-1131219 GACTCTGAGTGGCTACTAATGGG - Intergenic
1037997569 8:23364538-23364560 GACTGTGTGGGGTCACAAATGGG + Intronic
1039057566 8:33548793-33548815 GCCTCTGAGGGACTAGCAATGGG + Exonic
1039884501 8:41647413-41647435 GACTCTAAGGCGGTAGAAACCGG + Intronic
1042662605 8:71172000-71172022 GACTATGATCTGTTAGAAATGGG + Intergenic
1042793397 8:72633593-72633615 GACTCTGAGGGATCAGCACTTGG + Intronic
1047352703 8:124091000-124091022 GCCTCTGAGGGGTGGGAAAGAGG + Intronic
1048151667 8:131900897-131900919 GACACAGAGGGGATAGAAAGGGG + Intergenic
1051365212 9:16316976-16316998 GAGGCTCAGGGGTGAGAAATGGG + Intergenic
1052434679 9:28410940-28410962 GACACTGAGGGGAAAGCAATTGG - Intronic
1052930558 9:34052052-34052074 GGCTCTGAGGGGTGGGAAAGAGG + Intergenic
1058897293 9:109411398-109411420 GACTCTGAGGGGTTAGAAATAGG - Intronic
1059026017 9:110630899-110630921 CACTCTGATGGATGAGAAATGGG + Intergenic
1061258272 9:129465362-129465384 GCCTCTGAGGGGGTGGAATTTGG - Intergenic
1186307722 X:8282096-8282118 GCCTCTAAGGGGATGGAAATTGG + Intergenic
1188012362 X:25070979-25071001 TAATCTGTGGTGTTAGAAATCGG - Intergenic
1188293791 X:28420064-28420086 GACTCAGTTGGGGTAGAAATAGG - Intergenic
1188803340 X:34558424-34558446 GAGTCTGCTGGGTTAGAACTAGG + Intergenic
1190940371 X:55034528-55034550 CACTCTGAGGGGTGAAAAACTGG - Intergenic
1192013382 X:67299783-67299805 AACTCAGAGGGGTTGGAACTGGG - Intergenic
1192192723 X:69002232-69002254 GGCTCTAAGGGGTTAAAATTGGG + Intergenic
1194565782 X:95486167-95486189 CCCTCTTAGTGGTTAGAAATGGG - Intergenic
1194945311 X:100059675-100059697 TACCCTGAGGGGTTAGATTTTGG - Intergenic
1195476777 X:105295906-105295928 CACTTTGGGTGGTTAGAAATGGG - Intronic
1198060757 X:133043512-133043534 GTCAGTGAAGGGTTAGAAATAGG - Intronic
1198150572 X:133904459-133904481 TGCTCTGAGAGGTCAGAAATGGG + Intronic
1198217626 X:134570283-134570305 AAGGCTGAGGGGTTAGAGATGGG + Intronic
1200665885 Y:6022653-6022675 AACTCTGACATGTTAGAAATAGG + Intergenic