ID: 1058897296

View in Genome Browser
Species Human (GRCh38)
Location 9:109411409-109411431
Sequence TTAATCCCTGTGACTCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1917
Summary {0: 1, 1: 0, 2: 1, 3: 75, 4: 1840}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058897296_1058897303 6 Left 1058897296 9:109411409-109411431 CCCCTCAGAGTCACAGGGATTAA 0: 1
1: 0
2: 1
3: 75
4: 1840
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data
1058897296_1058897300 1 Left 1058897296 9:109411409-109411431 CCCCTCAGAGTCACAGGGATTAA 0: 1
1: 0
2: 1
3: 75
4: 1840
Right 1058897300 9:109411433-109411455 CATCCCTGCTGTCACTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058897296 Original CRISPR TTAATCCCTGTGACTCTGAG GGG (reversed) Intronic
900201588 1:1409973-1409995 TTAATCCATTTAACCCTGAGTGG - Intergenic
901030469 1:6304653-6304675 TTAATCCATTTAACCCTGAGTGG + Intronic
901341977 1:8502823-8502845 TTAATCCATTTAACCCTGAGTGG - Intronic
901386461 1:8912508-8912530 TTAATCCATTTAACTCTGAGTGG - Intergenic
901555686 1:10029485-10029507 TTAATCCATTTAACCCTGAGTGG - Intergenic
901726876 1:11249677-11249699 TTAATCCATTTAACCCTGAGTGG + Intronic
901849754 1:12008009-12008031 TTAATCCATTTAACCCTGAGTGG + Intronic
901970446 1:12903394-12903416 TTAATCCATTTAACCCTGAGTGG - Intronic
902014719 1:13298375-13298397 TTAATCCATTTAACCCTGAGTGG + Intergenic
902019171 1:13329812-13329834 TTAATCCATCTAACCCTGAGTGG - Intergenic
902248250 1:15136108-15136130 TTAATCCATTTAACCCTGAGTGG + Intergenic
902406531 1:16186929-16186951 TTAATCCTTGTAACTCTGCTAGG - Intergenic
903081893 1:20816978-20817000 TTAATCCATTTAACCCTGAGTGG - Intronic
903100522 1:21024626-21024648 TTAATCCATTTAACCCTGAGTGG - Intronic
903148666 1:21389490-21389512 TTAATCCATTTAACCCTGAGTGG - Intergenic
903162862 1:21502296-21502318 TTAATCCATTTAACCCTGAGTGG + Intergenic
903426609 1:23258164-23258186 TTAATCCATTTAACCCTGAGTGG - Intergenic
903458503 1:23504706-23504728 TTAATCCATTTAACCCTGAGTGG - Intergenic
903486003 1:23689488-23689510 TTAATCCATTTAACCCTGAGTGG - Intergenic
903508315 1:23853799-23853821 TTAATCCATTTAACCCTGAGTGG - Intronic
903519549 1:23936221-23936243 TTAATCCATTTAACCCTGAGTGG - Intergenic
903524962 1:23986796-23986818 TTAATCCATTTAACCCTGAGTGG + Intergenic
903525774 1:23992978-23993000 TTAATCCATTTAACCCTGAGTGG + Intergenic
903531109 1:24031685-24031707 TTAATCCATTTAACCCTGAGTGG + Intergenic
903634431 1:24800801-24800823 TTAATCCATTTAACCCTGAGTGG - Intronic
903637409 1:24832537-24832559 TTAATCCATTTAACCCTGAGTGG + Intronic
903895097 1:26597233-26597255 TTAATCCATTTAACCCTGAGTGG - Intergenic
903921292 1:26803139-26803161 TTAATCCATTTAACCCTGAGTGG + Intergenic
903962499 1:27065280-27065302 TTAATCCATTTAACCCTGAGTGG - Intergenic
903993159 1:27288609-27288631 TTAATCCATTTAACCCTGAGTGG + Intronic
904078099 1:27854819-27854841 TTAATCCATTTAACCCTGAGTGG - Intergenic
904414275 1:30346734-30346756 TTAATCCATTTAACCCTGAGTGG - Intergenic
904532349 1:31177398-31177420 TTAATCCATTTAACCCTGAGTGG - Intergenic
904722237 1:32518906-32518928 GTAATCCCAGCGACTTTGAGAGG - Intronic
904784276 1:32973730-32973752 TTAATCCATTTAACCCTGAGTGG + Intergenic
904795490 1:33053202-33053224 TTAATCCATTTAACCCTGAGTGG - Intronic
904831510 1:33309027-33309049 TTAATCCATTTAACCCTGAGTGG + Intronic
904838710 1:33356551-33356573 TTAATCCATTTAACCCTGAGTGG + Intronic
904857207 1:33508905-33508927 TTAATCCATTTAACCCTGAGTGG + Intergenic
904930468 1:34082804-34082826 TTAATCCATTTAACCCTGAGTGG - Intronic
905040093 1:34948487-34948509 TTAATCCATTTAACCCTGAGTGG - Intergenic
905041875 1:34967336-34967358 TTAATCCATTTAACCCTGAGTGG + Intergenic
905527207 1:38648048-38648070 TTAATCCATTTAACCCTGAGTGG - Intergenic
905598961 1:39234048-39234070 TTAATCCATTTAACCCTGAGTGG + Intronic
905644443 1:39615543-39615565 TCAATCACGGTGACTTTGAGTGG - Intergenic
905673536 1:39808673-39808695 TTAATCCATTTAACCCTGAGTGG - Intergenic
905680959 1:39870245-39870267 TTAATCCATTTAACCCTGAGTGG - Intronic
905699475 1:40000359-40000381 TTAATCCATTTAACCCTGAGTGG - Intergenic
905762531 1:40572192-40572214 TTAATCCATTTAACCCTGAGTGG - Intergenic
906036183 1:42751304-42751326 TTAATCCATTTAACCCTGAGTGG - Intronic
906136367 1:43502693-43502715 TTAATCCATTTAACCCTGAGTGG - Intergenic
906330055 1:44876931-44876953 TTAATCCATTTAACCCTGAGTGG - Intronic
906353363 1:45082063-45082085 TTAATCCATTTAACTCTGAGTGG - Intronic
906367609 1:45223587-45223609 TTAATCCATTTAACCCTGAGTGG - Intronic
906400080 1:45498116-45498138 TTAATCCATTTAACTCTGAGTGG - Intronic
906427580 1:45725824-45725846 TTAATCCATTTAACTCTGAGTGG - Intronic
906429046 1:45740081-45740103 TTAATCCATTTAACCCTGAGTGG + Intronic
906432315 1:45765316-45765338 TTAATCCATTTAACCCTGAGTGG + Intergenic
906487453 1:46242670-46242692 TTAATCCATTTAACCCTGAGTGG - Intergenic
906761297 1:48381964-48381986 TTAATCCATTTAACCCTGAGTGG + Intronic
907009892 1:50953128-50953150 TTAATCCATTTAACCCTGAGTGG - Intronic
907140752 1:52182485-52182507 TTAATCCATTTAACCCTGAGTGG - Intronic
907216486 1:52869503-52869525 TTAATCCATTTAACCCTGAGTGG + Intronic
907402680 1:54234082-54234104 TTAATCCATTTAACCCTGAGTGG - Intronic
907453336 1:54561361-54561383 TTAATCCATTTAACCCTGAGTGG + Intronic
907972801 1:59400891-59400913 TTAATCCCAAGCACTCTGAGAGG - Intronic
908370722 1:63474631-63474653 TTAATCCATTTAACCCTGAGTGG - Intronic
908446400 1:64202006-64202028 TTAATCCATTTAACCCTGAGTGG - Intergenic
909640745 1:77869201-77869223 TTAATCCATTTAACCCTGAGTGG + Intronic
909773261 1:79452916-79452938 TTAATACCTCTAACTCTGGGAGG - Intergenic
910344203 1:86217053-86217075 TTAATCCATTTAACCCTGAGTGG - Intergenic
910406714 1:86899043-86899065 TTAATCCATTTAACCCTGAGTGG + Intronic
910412574 1:86963418-86963440 TTAATCCATTTAACCCTGAGTGG + Intronic
910673636 1:89797462-89797484 TTAATCCATTTAACCCTGAGTGG + Intronic
910777440 1:90891428-90891450 TTAATCCATTTAACCCTGAGTGG + Intergenic
910891524 1:92025614-92025636 TTAATCCATTTAACCCTGAGTGG + Intergenic
911325726 1:96469356-96469378 TTAATCCATTTAACCCTGAGTGG + Intergenic
911351522 1:96761998-96762020 TTAATCCATTTAACCCTGAGTGG + Intronic
911396231 1:97314275-97314297 TTAGTCCCTGGGACCTTGAGGGG + Intronic
911486407 1:98512041-98512063 TTAATCCATTTAACCCTGAGTGG + Intergenic
911533883 1:99078222-99078244 TTAATCCATTTAACCCTGAGTGG + Intergenic
911598697 1:99824147-99824169 TTAATCCATTTAACCCTGAGTGG - Intergenic
912116448 1:106413083-106413105 TTAATCCATTTAACCCTGAGTGG - Intergenic
912266064 1:108159724-108159746 TTAATCCATTTAACCCTGAGTGG + Intronic
912297987 1:108488606-108488628 TTAATCCATTTAACTCTGAGTGG + Intergenic
912302860 1:108535735-108535757 TTAATCCATTTAACCCTGAGTGG + Intergenic
912317160 1:108676435-108676457 TTAATCCATTTAACCCTGAGTGG - Intergenic
912355905 1:109053917-109053939 TTAATCCATTTAACCCTGAGGGG - Intergenic
912358445 1:109074311-109074333 TTAATCCATTTAACCCTGAGGGG - Intronic
912629429 1:111233927-111233949 TTAATCCATTTAACCCTGAGTGG - Intronic
912668805 1:111607280-111607302 TTAATCCATTTAACCCTGAGTGG + Intronic
912690348 1:111800277-111800299 TTAATCCATTTAACCCTGAGTGG - Intronic
912752240 1:112294761-112294783 TTAATCCATTTAACCCTGAGTGG - Intergenic
912790115 1:112640957-112640979 TTAATCCATTTAACTCTGAGTGG - Intronic
912808431 1:112774696-112774718 TTAATCCATTTAACCCTGAGTGG - Intergenic
912825022 1:112897884-112897906 TTAATCCATTTAACCCTGAGTGG + Intergenic
912845415 1:113070868-113070890 TTAATCCATTTAACCCTGAGTGG - Intergenic
912942571 1:114058314-114058336 TTAATCCATTTAACCCTGAGTGG - Intergenic
912990352 1:114480214-114480236 TTAATCCATTTAACCCTGAGTGG - Intronic
913021025 1:114790220-114790242 TTAATCCATTTAACTCTGAGTGG + Intergenic
913022673 1:114804086-114804108 TTAATCCATTTAACCCTGAGTGG + Intergenic
913293864 1:117300437-117300459 TTAATCCATTTAACCCTGAGTGG + Intergenic
913305697 1:117429061-117429083 TTAATCCATTTAACCCTGAGTGG + Intronic
913994344 1:143639332-143639354 TTAATCCATTTAACCCTGAGTGG - Intergenic
914231119 1:145765155-145765177 TTAATCCATTTAACCCTGAGTGG - Intronic
914231214 1:145766253-145766275 TTAATCCATTTAACCCTGAGTGG + Intronic
914467916 1:147949019-147949041 TTAATCCATTTAACCCTGAGTGG + Intronic
914774929 1:150728207-150728229 TTAATCCATTTAACCCTGAGTGG + Intergenic
914780751 1:150782261-150782283 TTAATCCATTTAACCCTGAGTGG - Intergenic
914788113 1:150851593-150851615 TTAATCCATTTAACCCTGAGTGG - Intronic
914888393 1:151601458-151601480 TTAATCCATTTAACCCTGAGTGG - Intergenic
914893667 1:151650860-151650882 TTAATCCATTTAACCCTGAGTGG + Intronic
914908877 1:151768925-151768947 TTAATCCATTTAACCCTGAGTGG + Intronic
914953816 1:152144399-152144421 TTAATCCATTTAACCCTGAGTGG + Intergenic
914987242 1:152471663-152471685 TTAATCCATTTAACCCTGAGTGG + Intergenic
915114031 1:153583629-153583651 TTAATCCATTTAACCCTGAGTGG - Intergenic
915411122 1:155701414-155701436 TTAATCCATTTAACCCTGAGTGG - Intronic
915426993 1:155835203-155835225 TTAATCCATTTAACCCTGAGTGG - Intronic
915502512 1:156328592-156328614 TTAATCCATTTAACCCTGAGTGG - Intronic
915539900 1:156558858-156558880 TTAATCCATTTAACCCTGAGTGG - Intronic
916037487 1:160933887-160933909 TTAATCCATTTAACCCTGAGTGG - Intergenic
916037801 1:160936449-160936471 TTAATCCATTTAACCCTGAGTGG + Intergenic
916056405 1:161071597-161071619 TTAATTCCTGTGATTGTGAAAGG - Exonic
916131554 1:161616215-161616237 TTAATCCATTTAACCCTGAGTGG + Intronic
916205124 1:162308840-162308862 TTAATCCCAGCAACCCTGAGTGG + Intronic
916222362 1:162457633-162457655 TTAATCCATTTAACCCTGAGTGG - Intergenic
916223529 1:162466542-162466564 TTAATCCATTTAACCCTGAGTGG - Intergenic
916672049 1:167030159-167030181 TTAATCCATTTAACCCTGAGTGG - Intergenic
916799924 1:168207426-168207448 TTAATCCATTTAACCCTGAGTGG + Intergenic
917006352 1:170419615-170419637 TTAATCCATTTAACCCTGAGTGG - Intergenic
917126493 1:171693398-171693420 TTAATCCATTTAACCCTGAGTGG + Intergenic
917206145 1:172572435-172572457 TTAATCCATTTAACCCTGAGTGG - Intronic
917304809 1:173614004-173614026 TTAATCCATATAACCCTGAGTGG - Intronic
917375482 1:174348717-174348739 TTAATCCATTTAACCCTGAGTGG + Intronic
917469667 1:175315675-175315697 CAAATCACTGTGACACTGAGGGG - Exonic
917553438 1:176058493-176058515 TTAATCCATTTAACCCTGAGTGG - Intronic
917848144 1:179039991-179040013 TTAATCCATTTAACCCTGAGTGG + Intronic
917888969 1:179418248-179418270 TTAATCCATTTAACCCTGAGTGG + Intronic
918022619 1:180710460-180710482 TTAATCCCTTTAACCCTGAGTGG + Intronic
918099877 1:181364119-181364141 TTATTCCCCGTGACTCTGATTGG + Intergenic
918166612 1:181955205-181955227 TTAATCCATTTAACCCTGAGTGG - Intergenic
918172614 1:182011477-182011499 TTAATCCATTTAACCCTGAGTGG - Intergenic
918221319 1:182439516-182439538 TTAATCCATTTAACCCTGAGTGG + Intergenic
918228455 1:182508945-182508967 TTAATCCATTTAACCCTGAGTGG + Intronic
918254385 1:182735833-182735855 TTATTGCCTGTGTCTCTGTGAGG - Intergenic
918702052 1:187617456-187617478 TTAATCCATTTAACCCTGAGTGG - Intergenic
919129644 1:193437146-193437168 TTAATCCATTTAACTCTGAGTGG + Intergenic
919424019 1:197406311-197406333 TTAATCCATTTAACCCTGAGTGG - Intronic
919649164 1:200128609-200128631 TTAATGCCAGTGACTGTCAGAGG - Intronic
919925718 1:202191081-202191103 TTAATCCATTTAACCCTGAGTGG + Intergenic
919959317 1:202451429-202451451 TTAATCCATTTAACCCTGAGTGG + Intronic
919994815 1:202739733-202739755 TTAATCCATTTAACCCTGAGTGG + Intronic
920152085 1:203918824-203918846 TTAATCCATTTAACCCTGAGTGG + Intergenic
920451794 1:206065012-206065034 TTAATCCATTTAACTCTGAGTGG - Intronic
920749341 1:208659195-208659217 TTAATCCATTTAACCCTGAGTGG + Intergenic
920795161 1:209129940-209129962 TTAATCCATTTAACCCTGAGTGG - Intergenic
921016636 1:211197738-211197760 TTAATCCATTTAACCCTGAGTGG - Intergenic
921044172 1:211461221-211461243 TTAATCCATTTAACTCTGAGTGG - Intergenic
921106510 1:211986165-211986187 TTTATCCATGTGACTCTTGGTGG - Intronic
921109194 1:212015442-212015464 TTAATCCATTTAACCCTGAGTGG - Intronic
921139936 1:212298077-212298099 TTAATCCATCTAACCCTGAGTGG + Intronic
921198487 1:212780239-212780261 TTAATCCATTTAACCCTGAGTGG - Intronic
921208158 1:212867381-212867403 TTAATCCTCATGACTCTGTGAGG + Intronic
921413927 1:214868859-214868881 TTAATCCATTTAACCCTGAGTGG + Intergenic
921638228 1:217523432-217523454 TTAATCCATTTAACCCTGAGTGG + Intronic
921814311 1:219546604-219546626 TTAATCCATTTAACCCTGAGTGG - Intergenic
921845302 1:219873067-219873089 TTAATCCATTTAACCCTGAGTGG + Intronic
921902531 1:220465942-220465964 TTAATCCATTTAACCCTGAGTGG + Intergenic
922102959 1:222489104-222489126 TTAATCCATTTAACCCTGAGTGG - Intergenic
922278643 1:224101453-224101475 TTAATCCATTTAACCCTGAGTGG - Intergenic
922306423 1:224349480-224349502 TTAATCCATTTAACCCTGAGTGG + Intergenic
922437006 1:225616064-225616086 TTAATCCATTTAACCCTGAGTGG - Intronic
922458363 1:225795852-225795874 TTAATCCATTTAACCCTGAGTGG + Intergenic
922503661 1:226114558-226114580 TTAATCCATTTAACCCTGAGTGG + Intergenic
922633052 1:227133699-227133721 TTAATCCATTTAACCCTGAGTGG - Intronic
922645000 1:227276810-227276832 TTAATCCGTTTAACCCTGAGTGG - Intronic
922992950 1:229931577-229931599 TTAATCCATTTAACCCTGAGTGG + Intergenic
923174984 1:231454732-231454754 TTAATCCATTTAACCCTGAGTGG - Intergenic
923468091 1:234267137-234267159 TTAATCCATTTAACCCTGAGTGG + Intronic
923590075 1:235309913-235309935 TTAATCCATTTAACCCTGAGTGG - Intronic
923711161 1:236387735-236387757 TTAATCCATTTAACCCTGAGTGG - Intronic
923792850 1:237127043-237127065 TTAATCCATTTAACCCTGAGTGG + Intronic
923840763 1:237669135-237669157 TTAATCCATTTAACCCTGAGTGG + Intronic
924178357 1:241415974-241415996 TTAATCCATTTAACCCTGAGTGG - Intergenic
924824280 1:247522648-247522670 TTAATCCATTTAACCCTGAGTGG - Intronic
924925709 1:248677298-248677320 TTAATCCATTTAACCCTGAGTGG - Intergenic
1063084691 10:2806223-2806245 TTAATCCATTTAACCCTGAGTGG + Intergenic
1063745066 10:8869652-8869674 TTAATCCATTTAACCCTGAGTGG - Intergenic
1063776592 10:9272795-9272817 TTAATCCATTTAACCCTGAGTGG + Intergenic
1064108134 10:12518746-12518768 TTAATCCATTTAACCCTGAGTGG + Intronic
1064108942 10:12522456-12522478 TTAATCCATTTAACCCTGAGTGG + Intronic
1064663369 10:17628611-17628633 TTAATCCATTTAACTCTGAGTGG + Intergenic
1064824686 10:19383646-19383668 TTAATCCTTGTAACTCTGAAAGG + Intronic
1065012348 10:21430935-21430957 TTAATCCATTTAACCCTGAGTGG - Intergenic
1065055560 10:21838358-21838380 TTAATCCATTTAACCCTGAGTGG - Intronic
1065191875 10:23219604-23219626 TAAATCCTTGTTACTCTAAGGGG - Intronic
1065336512 10:24657786-24657808 TTAATCCATTTAACCCTGAGTGG - Intronic
1065594120 10:27295820-27295842 TTAATCCATTTAACCCTGAGTGG + Intergenic
1065738167 10:28772394-28772416 TTAATCCATTTAACCCTGAGTGG - Intergenic
1065840630 10:29697552-29697574 TTAATCCATTTAACCCTGAGTGG - Intronic
1066085900 10:31971350-31971372 TTAATCCATCTAACCCTGAGTGG - Intergenic
1066086734 10:31978909-31978931 TTAATCCATTTAACCCTGAGTGG + Intergenic
1066115147 10:32233161-32233183 TTAATCCATTTAACCCTGAGTGG + Intergenic
1066325445 10:34353451-34353473 TTAATCCATTTAACCCTGAGTGG - Intronic
1066390970 10:34977016-34977038 TTAATCCATTTAACCCTGAGTGG - Intergenic
1066437278 10:35406488-35406510 TTAATCCATTTAACCCTGAGTGG + Intronic
1066953017 10:42138736-42138758 TTAATCCATTTAACCCTGAGTGG - Intergenic
1066986563 10:42473652-42473674 TTGCTCCCTGTAACTTTGAGTGG - Intergenic
1067026656 10:42848061-42848083 TTAATCCATTTAACCCTGAGTGG - Intergenic
1067128984 10:43544373-43544395 TTAATCCATTTAACCCTGAGTGG - Intergenic
1067325394 10:45260731-45260753 TTAATCCATTTAACCCTGAGTGG - Intergenic
1067339940 10:45392443-45392465 TTAATCCATTTAACCCTGAGTGG - Intronic
1067354705 10:45512960-45512982 TTAATCCATTTAACCCTGAGTGG - Intronic
1067391086 10:45865048-45865070 TTAATCCATTTAACCCTGAGTGG + Intergenic
1067813990 10:49457503-49457525 CTCATCCATGTGACTCAGAGAGG - Exonic
1067872194 10:49971063-49971085 TTAATCCATTTAACCCTGAGTGG - Intronic
1068005816 10:51392390-51392412 TTAATCCATTTAACCCTGAGTGG + Intronic
1068656774 10:59583959-59583981 TTAACCCCTGTGAGACTAAGGGG - Intergenic
1068969984 10:62948828-62948850 TTAATCCATTTAACCCTGAGTGG - Intergenic
1069052497 10:63811035-63811057 TTAATCCATTTAACCCTGAGTGG + Intergenic
1069302444 10:66925605-66925627 ATAATCACTGTGACTCCAAGAGG + Intronic
1069733112 10:70631732-70631754 TTAATCCATTTAACCCTGAGTGG - Intergenic
1069740868 10:70686544-70686566 TTAATCCATTTAACCCTGAGTGG + Intronic
1070317779 10:75332734-75332756 TTAATCCATTTAACCCTGAGTGG + Intergenic
1070367259 10:75749888-75749910 TTAATCCATTTAACCCTGAGTGG + Intronic
1070683926 10:78468197-78468219 TTAATCCATTTAACCCTGAGTGG + Intergenic
1071003539 10:80857386-80857408 TTAATCCCTGAGTCACTGGGTGG + Intergenic
1071138379 10:82478512-82478534 TTAATCCATTTAACCCTGAGTGG + Intronic
1071311279 10:84347040-84347062 TTAATCCATTTAACCCTGAGTGG + Intronic
1071538435 10:86455416-86455438 TTAATCCATTTAACCCTGAGTGG - Intronic
1071616780 10:87081683-87081705 TTAATCCATTTAACCCTGAGTGG - Intronic
1071883715 10:89927272-89927294 TTCATGCCTGTGAATCTGTGCGG + Intergenic
1072117413 10:92377168-92377190 TTAATCCATTTAACCCTGAGTGG - Intergenic
1072149438 10:92673989-92674011 TTAATCCATTTAACCCTGAGTGG + Intergenic
1072291868 10:93971346-93971368 TTAATCCATTTAACCCTGAGTGG - Intergenic
1072602022 10:96940574-96940596 TTAATCCATTTAACCCTGAGTGG + Intronic
1072648905 10:97277332-97277354 TTAATCCATTTAACCCTGAGTGG - Intronic
1072684139 10:97527710-97527732 TTAATCCATTTAACCCTGAGTGG + Intronic
1072730463 10:97842204-97842226 TTAATCCATTTAACCCTGAGTGG - Intergenic
1072772570 10:98153346-98153368 TTAATCCATTTAACCCTGAGTGG - Intronic
1072949208 10:99837731-99837753 TTAATCCATTTAACCCTGAGTGG + Intronic
1072956648 10:99892493-99892515 TTAATCCATTTAACCCTGAGTGG - Intronic
1072980660 10:100094280-100094302 TTAATCCATTTAACCCTGAGTGG - Intergenic
1073000177 10:100278568-100278590 TTAATCCATTTAACCCTGAGTGG - Intronic
1073238379 10:102036609-102036631 TTAATCCATTTAACCCTGAGTGG - Intronic
1073274812 10:102301240-102301262 TTAATCCATTTAACCCTGAGTGG + Intronic
1073386593 10:103130290-103130312 TTAATCCATTTAACCCTGAGTGG - Intronic
1073594379 10:104785317-104785339 TTAATCCATTTAACCCTGAGTGG - Intronic
1073606659 10:104902357-104902379 TGAATTCCAGTGACTCTGAGAGG + Intronic
1073865712 10:107801268-107801290 TTAATCCATTTAACCCTGAGTGG - Intergenic
1074151843 10:110766584-110766606 TTAATCCATTTAACCCTGAGTGG + Intronic
1074588252 10:114788065-114788087 TTAATCCATTTAACCCTGAGTGG - Intergenic
1075000779 10:118795482-118795504 TTAATCCATTTAACCCTGAGTGG - Intergenic
1075050716 10:119181563-119181585 TTAATCCATTTAACCCTGAGTGG + Intergenic
1075061544 10:119260664-119260686 TTAATCCATTTAACTCTGAGTGG + Intronic
1075108424 10:119559181-119559203 TTAATCCATTTAACCCTGAGTGG + Intergenic
1075129026 10:119722810-119722832 TTAATCCATTTAACCCTGAGTGG - Intergenic
1075181302 10:120214724-120214746 TTAATCCATTTAACCCTGAGTGG + Intergenic
1075842883 10:125518913-125518935 TTAATCCATTTAACCCTGAGTGG - Intergenic
1075947469 10:126448848-126448870 TTACTCACTGTGACTCTGTTAGG - Intronic
1076011692 10:126994579-126994601 TTAATCCGTTTAACCCTGAGTGG + Intronic
1076626632 10:131824922-131824944 TTCCTCCCTGTGACCCTGTGTGG - Intergenic
1076914297 10:133414174-133414196 TTAATCCATTTAACCCTGAGTGG + Intronic
1077397743 11:2333199-2333221 TTAATCCATTTAACCCTGAGTGG - Intergenic
1077577821 11:3397809-3397831 TTAATCCATTTAACCCTGAGTGG - Intergenic
1077668417 11:4137028-4137050 TTAATCCATTTAACCCTGAGTGG + Intronic
1077680847 11:4238313-4238335 TTAATCCATTTAACCCTGAGTGG - Intergenic
1077839797 11:5961483-5961505 TTAATCCATTTAACCCTGAGTGG - Intergenic
1077926985 11:6690890-6690912 TTAATCCATTTAACCCTGAGTGG + Intergenic
1078122541 11:8524051-8524073 TTAATCCATTTAACCCTGAGTGG - Intronic
1078177281 11:8979259-8979281 TTAATCCATTTAACCCTGAGTGG - Intergenic
1078254684 11:9647918-9647940 TTAATCCTACTGTCTCTGAGTGG + Intergenic
1079018441 11:16888578-16888600 TTAATCCATTTAACCCTGAGTGG - Intronic
1079020899 11:16907999-16908021 TTAATCCATTTAACCCTGAGTGG - Intronic
1079039583 11:17049860-17049882 TTAATCCATTTAACCCTGAGTGG + Intergenic
1079160500 11:17988410-17988432 TACAAACCTGTGACTCTGAGAGG + Intronic
1079174057 11:18121735-18121757 TTAATCCATTTAACCCTGAGTGG - Intronic
1079371726 11:19859399-19859421 TTAATCCATTTAACCCTGAGTGG + Intronic
1079445100 11:20549347-20549369 TTAATCCATTTAACCCTGAGTGG - Intergenic
1079467291 11:20743054-20743076 TTAAATCCAGTGACTCTGGGTGG + Intronic
1080098440 11:28431515-28431537 TTAATCCATTTAACCCTGAGTGG - Intergenic
1080405006 11:31971295-31971317 TTAATCCATTTAACCCTGAGTGG + Intronic
1080538513 11:33244311-33244333 TTAATCCATTTAACCCTGAGTGG - Intergenic
1080620998 11:33986736-33986758 TTAATCCATTTAACCCTGAGTGG - Intergenic
1081289348 11:41305639-41305661 TTAATCCATTTAACCCTGAGTGG - Intronic
1081627553 11:44664359-44664381 TTAATCCATTTAACCCTGAGTGG - Intergenic
1081784514 11:45737785-45737807 TTAATCCATTTAACCCTGAGTGG + Intergenic
1081895772 11:46585086-46585108 TTAATCCATTTAACCCTGAGTGG - Intronic
1081934835 11:46897632-46897654 TTAATCCATTTAACCCTGAGTGG + Intronic
1081956626 11:47098042-47098064 TTAATCCATTTAACCCTGAGTGG - Intronic
1082044946 11:47717871-47717893 GTAATCCCAGCTACTCTGAGGGG - Intronic
1082166269 11:48955096-48955118 TTAATCCATTTAACCCTGAGTGG + Intergenic
1082233549 11:49797802-49797824 TTAATCCATTTAACCCTGAGTGG + Intergenic
1082244949 11:49911354-49911376 TTAATCCATTTAACCCTGAGTGG + Intergenic
1082258917 11:50062812-50062834 TTAATCCATTTAACCCTGAGTGG + Intergenic
1082678936 11:56144294-56144316 TTAATCCATTTAACCCTGAGTGG - Intergenic
1082706371 11:56497833-56497855 TTAATCCATTTAACCCTGAGTGG - Intergenic
1082844397 11:57715841-57715863 TTAATCCATTTAACCCTGAGTGG + Intronic
1083030362 11:59585902-59585924 TTAATCCATTTAACCCTGAGTGG - Intronic
1083042402 11:59700280-59700302 TTAATCCATTTAACCCTGAGTGG - Intergenic
1083090947 11:60200549-60200571 TTAATCCATTTAACCCTGAGTGG + Intergenic
1083131142 11:60623381-60623403 TTAATCCATTTAACCCTGAGTGG - Intergenic
1083154867 11:60816092-60816114 TTAATCCATTTAACCCTGAGTGG - Intergenic
1083208144 11:61166016-61166038 TTAATCCATTTAACCCTGAGTGG + Intergenic
1083382791 11:62280030-62280052 TTAATCCATTTAACCCTGAGTGG - Intergenic
1083645562 11:64171010-64171032 TTAATCCATTTAACCCTGAGTGG + Intergenic
1083832235 11:65240038-65240060 TTAATCCATTTAACCCTGAGTGG - Intergenic
1083865831 11:65452207-65452229 TTAATCCATTTAACCCTGAGTGG - Intergenic
1083917893 11:65762450-65762472 TTAATCCATTTAACCCTGAGTGG + Intergenic
1084049288 11:66588830-66588852 TTAATCCATTTAACCCTGAGTGG - Intergenic
1084140147 11:67222332-67222354 TTAATCCATTTAACCCTGAGTGG + Intronic
1084186859 11:67477689-67477711 TTAATCCATTTAACCCTGAGTGG + Intergenic
1084206485 11:67597738-67597760 TTAATCCATTTAACCCTGAGTGG + Intergenic
1084338251 11:68475174-68475196 TTAATCCATTTAACCCTGAGTGG + Intronic
1084388919 11:68862078-68862100 TTAATCCATTTAACCCTGAGTGG - Intergenic
1084624069 11:70294812-70294834 TTAATCCATTTAACCCTGAGTGG + Intronic
1084645722 11:70456549-70456571 TTAATCCATTTAACCCTGAGTGG + Intergenic
1084745405 11:71167047-71167069 TTAATCCATTTAACCCTGAGTGG + Intronic
1084839364 11:71831990-71832012 TTAATCCATTTAACCCTGAGTGG - Intergenic
1084924475 11:72501772-72501794 TTAATCCATTTAACCCTGAGTGG + Intergenic
1085073897 11:73572611-73572633 TTAATCCATTTAACCCTGAGTGG - Intronic
1085097934 11:73775659-73775681 TTAATCCATTTAACCCTGAGTGG - Intergenic
1085116361 11:73935845-73935867 TTAATCCATTTAACCCTGAGTGG + Intergenic
1085159733 11:74328865-74328887 TTAATCCATTTAACCCTGAGTGG - Intergenic
1085161677 11:74353595-74353617 TTAATCCATTTAACCCTGAGTGG + Intronic
1085189387 11:74605411-74605433 ATGATCCCTGTGCCCCTGAGAGG - Intronic
1085292237 11:75409444-75409466 TTAATCCATTTAACCCTGAGTGG + Intronic
1085359795 11:75877107-75877129 TTAATCCATTTAACCCTGAGTGG + Intronic
1085492430 11:76933541-76933563 TTAATCCATTTAACCCTGAGTGG + Intronic
1085512945 11:77097729-77097751 TTAATCCATTTAACCCTGAGTGG + Intronic
1085563388 11:77490864-77490886 TTAATCCATTTAACCCTGAGTGG - Intergenic
1085609548 11:77934126-77934148 TTAATCCATTTAACCCTGAGTGG - Intronic
1085754666 11:79192503-79192525 TTAATCCATTTAACCCTGAGTGG - Intronic
1086017382 11:82182599-82182621 TTAATCCATTTAACCCTGAGTGG - Intergenic
1086104614 11:83133916-83133938 TTAATCCATTTAACCCTGAGTGG - Intergenic
1086341596 11:85853396-85853418 TTAATCCATTTAACCCTGAGTGG - Intergenic
1086366483 11:86111861-86111883 TTAATCCATTTAACCCTGAGTGG - Intergenic
1086430670 11:86732883-86732905 TTAATCCATTTAACCCTGAGTGG - Intergenic
1086434777 11:86770438-86770460 TTAATCCATTTAACCCTGAGTGG + Intergenic
1086447189 11:86880181-86880203 TTAATCCATTTAACCCTGAGTGG - Intronic
1086697400 11:89861333-89861355 TTAATCCATTTAACCCTGAGTGG - Intergenic
1086708759 11:89983154-89983176 TTAATCCATTTAACCCTGAGTGG + Intergenic
1086881818 11:92158644-92158666 TTAATCCATTTAACCCTGAGTGG - Intergenic
1087056978 11:93946346-93946368 TTAATCCATTTAACCCTGAGTGG + Intergenic
1087198061 11:95320488-95320510 TTAATCCATTTAACCCTGAGTGG + Intergenic
1087214904 11:95483142-95483164 TTAATCCATTTAACCCTGAGTGG - Intergenic
1087486977 11:98769850-98769872 TTAATCCATTTAACCCTGAGTGG + Intergenic
1087948869 11:104195362-104195384 TTAATCCATTTAACCCTGAGTGG - Intergenic
1088257315 11:107913210-107913232 TTAATCCATTTAACCCTGAGTGG - Intronic
1088373579 11:109117300-109117322 ACTAGCCCTGTGACTCTGAGTGG - Intergenic
1088658787 11:112026583-112026605 TTAATCCATTTAACCCTGAGTGG + Intronic
1088823717 11:113476510-113476532 TTAATCCTTGTGGCCCAGAGAGG - Intergenic
1089148641 11:116347784-116347806 TTAATCCATTTAACCCTGAGTGG - Intergenic
1089420592 11:118330544-118330566 TTAATCCATTTAACCCTGAGTGG + Intergenic
1089510032 11:118991252-118991274 TTAATCCATTTAACCCTGAGTGG + Intergenic
1089520315 11:119058877-119058899 TTAATCCATTTAACCCTGAGTGG + Intergenic
1089585360 11:119507248-119507270 TTAATCCATTTAACCCTGAGTGG + Intergenic
1090152738 11:124403088-124403110 TTAATCCATTTAACCCTGAGTGG + Intergenic
1090181683 11:124705065-124705087 TTAATCCATTTAACCCTGAGTGG - Intergenic
1090499828 11:127250598-127250620 CTGAGCCCTGTGCCTCTGAGAGG - Intergenic
1090499981 11:127251950-127251972 TTATTGCTTGTGATTCTGAGTGG - Intergenic
1090762167 11:129847646-129847668 TTAATCCATTTAACCCTGAGTGG + Intronic
1090790613 11:130090522-130090544 TTAATCCATTTAACCCTGAGTGG + Intronic
1090906767 11:131083902-131083924 TTAATCCATTTAACCCTGAGTGG + Intergenic
1091238934 11:134039595-134039617 CTCATCCCTGTGTTTCTGAGGGG + Intergenic
1091378913 12:43038-43060 TTAATCCATTTAACCCTGAGTGG - Intergenic
1091586247 12:1818506-1818528 TTAATCCATTTAACCCTGAGTGG - Intronic
1091960392 12:4689559-4689581 TTAATCCATTTAACCCTGAGTGG + Exonic
1092121563 12:6047816-6047838 TCAATCACTGGGACACTGAGTGG - Intronic
1092185349 12:6475066-6475088 TTAATCCATTTAACCCTGAGTGG + Intergenic
1092331176 12:7589435-7589457 TTAATCCATTTAACCCTGAGTGG + Intergenic
1092454061 12:8626505-8626527 TTAATCCATTTAACCCTGAGTGG - Intergenic
1092591305 12:9953945-9953967 TTAATCCATTTAACCCTGAGTGG - Intronic
1092722829 12:11458738-11458760 TTAATCCATTTAACCCTGAGTGG - Intronic
1092827318 12:12413339-12413361 TTAATCCATTTAACCCTGAGTGG + Intronic
1092843949 12:12566643-12566665 TTAATCCATTTAACCCTGAGTGG - Intergenic
1092849935 12:12617928-12617950 TTAATCCATTTAACCCTGAGTGG + Intronic
1093038628 12:14355259-14355281 TTAATCCATTTAACCCTGAGTGG - Intergenic
1093175851 12:15912276-15912298 TTAATCCATTTAACCCTGAGTGG + Intronic
1093758317 12:22877162-22877184 ATAATCCCAGTTACTCCGAGAGG - Intergenic
1093904420 12:24673682-24673704 TTAATCCATTTAACCCTGAGTGG + Intergenic
1093927917 12:24926693-24926715 TTAATCCATTTAACCCTGAGTGG - Intronic
1094103648 12:26786188-26786210 TTAATCCATTTAACCCTGAGTGG - Intronic
1094209535 12:27874587-27874609 TTAATCCATTTAACCCTGAGTGG - Intergenic
1094238856 12:28200543-28200565 TTAATCCATTTAACCCTGAGTGG + Intronic
1094670193 12:32562670-32562692 TTAATCCATTTAACCCTGAGTGG + Intronic
1094716840 12:33022431-33022453 TTAATCCATTTAACCCTGAGTGG + Intergenic
1095068418 12:37813984-37814006 TTAATCCATTTAACCCTGAGTGG + Intergenic
1095085517 12:38054726-38054748 TTACTCCATGTGAGTCTGACTGG + Intergenic
1095113747 12:38329998-38330020 TTAATCCATTTAACCCTGAGTGG + Intergenic
1095280986 12:40352720-40352742 TTAATCCATTTAACCCTGAGTGG + Intronic
1095440035 12:42229147-42229169 TTAATCCATTTAACCCTGAGTGG - Intronic
1095571374 12:43686065-43686087 TTAATCCATTTAACCCTGAGTGG - Intergenic
1095884031 12:47170155-47170177 TTAATCCATTTAACCCTGAGTGG + Intronic
1096021847 12:48331960-48331982 TTAATCCATTTAACCCTGAGTGG + Intergenic
1096039207 12:48499983-48500005 TTAATCCATTTAACCCTGAGTGG + Intergenic
1096041292 12:48520066-48520088 TTAATCCATTTAACCCTGAGTGG + Intronic
1096064099 12:48725301-48725323 TTAATCCATTTAACCCTGAGTGG - Intergenic
1096092900 12:48915370-48915392 TTAATCCACTTAACTCTGAGTGG + Intronic
1096146615 12:49283244-49283266 TTAATCCATTTAACTCTGAGTGG + Intergenic
1096225199 12:49861719-49861741 TTAATCCATTTAACCCTGAGTGG - Intergenic
1096660711 12:53122591-53122613 TTAATCCATTTAACCCTGAGTGG + Intronic
1096708442 12:53438024-53438046 TTAATCCATTTAACCCTGAGTGG - Intergenic
1096856437 12:54487740-54487762 TTAATCCATTTAACCCTGAGTGG + Intergenic
1096951454 12:55478721-55478743 TTAATCCATTTGACCCTGAGTGG + Intergenic
1097028368 12:56075354-56075376 TTAATCCATTTAACCCTGAGTGG + Intergenic
1097126763 12:56782900-56782922 TTAATCCATTTAACCCTGAGTGG + Intronic
1097127717 12:56788715-56788737 TTAATCCATTTAACCCTGAGTGG + Intergenic
1097149298 12:56964249-56964271 TTAATCCATTTAACCCTGAGTGG - Intergenic
1097228480 12:57494766-57494788 TTAATCCATTTAACCCTGAGTGG + Intronic
1097230290 12:57507110-57507132 TTAATCCATTTAACCCTGAGTGG + Intronic
1098019314 12:66135797-66135819 TTAATCCATTTAACCCTGAGTGG - Intronic
1098370797 12:69759244-69759266 TTAATCCATTTAACCCTGAGTGG + Intronic
1098413223 12:70203497-70203519 TTAATCCATTTAACCCTGAGTGG - Intergenic
1098884097 12:75942848-75942870 TTAATCCATTTAACCCTGAGTGG - Intergenic
1099971463 12:89504340-89504362 TTAATCCATTTAACCCTGAGTGG - Intronic
1100003586 12:89867355-89867377 TTAATCCATTTAACCCTGAGTGG + Intergenic
1100488491 12:95055014-95055036 TTAATCCATTTAACCCTGAGTGG + Intronic
1100570187 12:95840098-95840120 TTAATCCATTTAACCCTGAGTGG + Intergenic
1100577453 12:95907082-95907104 TTAATCCATTTAACCCTGAGTGG + Intronic
1100582575 12:95948866-95948888 TTAATCCATTTAACCCTGAGTGG - Intronic
1100845600 12:98655088-98655110 TTAATCCATTTAACCCTGAGTGG + Intronic
1100994854 12:100293787-100293809 TTAATCCATTTAACCCTGAGTGG + Intronic
1101317736 12:103644267-103644289 TTAATCCATTTAACCCTGAGTGG - Intronic
1101393277 12:104323062-104323084 TTAATCCATTTAACCCTGAGTGG + Intronic
1101562679 12:105873523-105873545 TTAATCCATTTAACCCTGAGTGG - Intergenic
1101853214 12:108420987-108421009 TTAATCCATTTAACCCTGAGTGG - Intergenic
1101885383 12:108656784-108656806 TTAATCCATTTAACCCTGAGTGG - Intronic
1102089535 12:110173700-110173722 TTAATCCATTTAACCCTGAGTGG - Intronic
1102174503 12:110866577-110866599 TTAATCCATTTAACCCTGAGTGG + Intronic
1102186060 12:110950202-110950224 TTAATCCATTTAACCCTGAGTGG + Intergenic
1102293745 12:111722644-111722666 TTAATCCATTTAACCCTGAGTGG + Intronic
1102578906 12:113873415-113873437 TTAATCCATTTAACCCTGAGTGG - Intronic
1102656191 12:114484519-114484541 TTAATCCATTTAACCCTGAGTGG + Intergenic
1103045526 12:117731770-117731792 TTAATCCATTTAACCCTGAGTGG - Intronic
1103234318 12:119359792-119359814 TTAATCCATTTAACTCTGAGTGG + Intronic
1103299595 12:119918064-119918086 TTAATCCATTTAACCCTGAGTGG + Intergenic
1103413926 12:120731896-120731918 TTAATCCATTTAACCCTGAGTGG + Intronic
1103457494 12:121077351-121077373 TTAATCCATTTAACCCTGAGTGG - Intergenic
1103535934 12:121633949-121633971 TTAATCCGTTTAACCCTGAGTGG + Intronic
1103591603 12:121994693-121994715 TTAATCCATTTAACCCTGAGTGG - Intronic
1103641938 12:122358174-122358196 TTAATCCATTTAACCCTGAGTGG - Intronic
1103794293 12:123492806-123492828 TTAATCCATTTAACCCTGAGTGG - Intronic
1104712375 12:130996036-130996058 TTAATCCATTTAACCCTGAGTGG + Intronic
1104861352 12:131925994-131926016 TTAATCCATTTAACCCTGAGTGG + Intergenic
1105368222 13:19780546-19780568 TTAATCCATTTAACCCTGAGTGG - Intronic
1105508580 13:21032683-21032705 ATAATCCCTAAGACCCTGAGAGG + Intronic
1105526864 13:21185975-21185997 TTAATCCATTTAACCCTGAGTGG + Intergenic
1105556256 13:21448953-21448975 TTAATCCATTTAACCCTGAGTGG - Intronic
1105692715 13:22858666-22858688 TTAATCCATTTAACCCTGAGTGG + Intergenic
1105808286 13:23972179-23972201 TTAATCCATTTAACCCTGAGTGG + Intergenic
1105921635 13:24969932-24969954 TTAATCCATTTAACCCTGAGTGG + Intergenic
1105976636 13:25479749-25479771 TTAATCCATTTAACCCTGAGTGG + Intronic
1105980209 13:25512144-25512166 TTAATCCATTTAACCCTGAGTGG + Intronic
1106104951 13:26724552-26724574 TTAATCCATTTAACCCTGAGTGG - Intergenic
1106114506 13:26805930-26805952 TTAATCCATTTAACCCTGAGTGG + Intergenic
1106495502 13:30270647-30270669 TTAATCCATTTAACCCTGAGTGG - Intronic
1106559856 13:30838842-30838864 TTAATCCATTTAACCCTGAGTGG + Intergenic
1106680340 13:32000859-32000881 TTAATCCGTTTAACCCTGAGTGG - Intergenic
1106747145 13:32717426-32717448 TTAATCCATGTAACCCTGAGTGG - Intronic
1106885703 13:34181861-34181883 TTAATCCATTTAACCCTGAGTGG - Intergenic
1107166072 13:37281124-37281146 TTAATCCATTTAACCCTGAGTGG - Intergenic
1107493494 13:40901631-40901653 TTAATCCATTTAACCCTGAGTGG - Intergenic
1107644141 13:42476709-42476731 TTAATCCATTTAACCCTGAGTGG - Intergenic
1107692583 13:42967015-42967037 TTAATCCATTTAACCCTGAGTGG - Intronic
1107749726 13:43552066-43552088 TTTCGCCCTGTCACTCTGAGAGG + Intronic
1107863350 13:44682022-44682044 TTAATCCATTTAACCCTGAGTGG + Intergenic
1107953156 13:45484859-45484881 TTAATCCATTTAACCCTGAGTGG + Intronic
1108024508 13:46163371-46163393 TTAATCCATTTAACCCTGAGTGG - Intronic
1108059059 13:46515153-46515175 TTAATCCATTTAACCCTGAGTGG + Intergenic
1108310376 13:49183720-49183742 AAAATCCATGTGACTGTGAGAGG + Intronic
1108330697 13:49379431-49379453 TTAATCCATTTAACCCTGAGTGG - Intronic
1108341888 13:49504950-49504972 TTAATCCATTTAACCCTGAGTGG - Intronic
1108348184 13:49565996-49566018 TTAATCCATTTAACCCTGAGTGG - Intronic
1108351684 13:49593959-49593981 TTAATCCATTTAACCCTGAGTGG - Intergenic
1108370499 13:49762600-49762622 TTAATCCATTTAACCCTGAGTGG - Intronic
1108502187 13:51078643-51078665 TTAATCCATTTAACCCTGAGTGG - Intergenic
1108610682 13:52080627-52080649 TTAATCCATTTAACCCTGAGTGG - Intronic
1108763706 13:53601247-53601269 GAAATCCCTGTGGCTTTGAGGGG + Intergenic
1110252620 13:73397536-73397558 TTCTTCCCTGTGACACTGACTGG - Intergenic
1110269742 13:73575942-73575964 TTAATCCATTTAACCCTGAGTGG - Intergenic
1110922289 13:81102745-81102767 TTAATCCATTTAACCCTGAGTGG - Intergenic
1111388681 13:87562159-87562181 TTAATCCATTTAACCCTGAGTGG - Intergenic
1111418065 13:87975869-87975891 TTAATCCATTTAACCCTGAGTGG + Intergenic
1111973219 13:94939060-94939082 TGAATCCCTTTCACTCTGAAAGG - Intergenic
1112420208 13:99241996-99242018 TTAATCCATTTAACCCTGAGTGG + Intronic
1112573914 13:100618748-100618770 TTAATCCATTCAACTCTGAGTGG + Intronic
1112590745 13:100761769-100761791 TTAATCCATTTAACTCTGAGTGG + Intergenic
1113329241 13:109312118-109312140 TTAATCCATTTAACCCTGAGTGG - Intergenic
1113915348 13:113867440-113867462 TTAATCCATTTAACCCTGAGTGG - Intergenic
1114137378 14:19867007-19867029 TTAATCCATTTAACCCTGAGTGG - Intergenic
1114170562 14:20269089-20269111 TTAATCCATTTAACCCTGAGTGG - Intronic
1114175088 14:20311010-20311032 TTAATCCATTTAACCCTGAGTGG - Intergenic
1114187004 14:20410344-20410366 GCAATCCCAGTGACTCTCAGAGG + Intronic
1114191635 14:20443535-20443557 TTAATCCATTTAACCCTGAGTGG - Intergenic
1114199570 14:20507349-20507371 TTAATCCATTTAACCCTGAGTGG - Intronic
1114280542 14:21189201-21189223 TTAATCCATTTAACCCTGAGTGG - Intergenic
1114336752 14:21698311-21698333 TTAATCCATTTAACCCTGAGTGG - Intergenic
1114428104 14:22638388-22638410 TTAATCCATTTAACCCTGAGTGG - Intergenic
1114428399 14:22639720-22639742 TTAATCCATTTAACCCTGAGTGG - Intergenic
1114491912 14:23107953-23107975 TTAATCCATTTAACCCTGAGTGG + Intergenic
1114578806 14:23737281-23737303 TTAATCCATTTAACCCTGAGTGG - Intergenic
1114647758 14:24265003-24265025 CTCATCCCTGAGACTCTGTGAGG + Intergenic
1115271604 14:31559787-31559809 TTAATCCATTTAACCCTGAGTGG + Intronic
1115470641 14:33765376-33765398 TTAATTCCGGGGATTCTGAGAGG - Intronic
1115493825 14:33984049-33984071 TTAATCCATTTTACCCTGAGTGG + Intronic
1115547567 14:34476647-34476669 TTAATCCATTTAACCCTGAGTGG - Intergenic
1115571369 14:34669676-34669698 ATAATCCCTAGCACTCTGAGAGG - Intergenic
1115610035 14:35039994-35040016 TTAATCCATTTAACCCTGAGTGG - Intergenic
1115688773 14:35824213-35824235 TTAATCCATTTAACCCTGAGTGG + Intergenic
1115703193 14:35976401-35976423 TTAATCCATTTAACCCTGAGTGG + Intergenic
1115847380 14:37554910-37554932 TTAATCCATTTAACCCTGAGTGG + Intergenic
1115860114 14:37676105-37676127 TTAATGACGGTGATTCTGAGAGG + Intronic
1116409249 14:44601967-44601989 TTAATCCATTTAACCCTGAGTGG - Intergenic
1116480860 14:45390565-45390587 TTAATCCATTTAACCCTGAGTGG - Intergenic
1116841384 14:49822045-49822067 TTAATCCATTTAACCCTGAGTGG - Intronic
1116871799 14:50074647-50074669 TTAATCCATTTAACCCTGAGTGG - Intergenic
1117027930 14:51640707-51640729 TTAATCCATATGAATCTGATTGG + Intronic
1117277508 14:54204628-54204650 TTAATCCATTTAACCCTGAGTGG - Intergenic
1117335275 14:54752090-54752112 TGGGTCCCTGTGACTCTGATAGG + Intronic
1117411574 14:55455964-55455986 TTAATCCATTTAACCCTGAGTGG + Intronic
1117716753 14:58588884-58588906 TTAATCCATTTAACCCTGAGTGG - Intergenic
1117763582 14:59058548-59058570 TTAATCCATTTAACCCTGAGTGG + Intergenic
1117837468 14:59821976-59821998 TTATTCACTGTGTCTCTGACAGG + Intronic
1118076744 14:62307934-62307956 TTAGTCCCACTGACTTTGAGAGG + Intergenic
1118148916 14:63166553-63166575 TTAATCCATTTAACCCTGAGTGG - Intergenic
1118238791 14:64037390-64037412 TTAATCCATTTAACCCTGAGTGG + Intronic
1118327676 14:64792590-64792612 TTAAGCCAGGAGACTCTGAGGGG - Intronic
1118340683 14:64894402-64894424 TTAATCCATTTAACCCTGAGTGG + Intergenic
1118423682 14:65634299-65634321 TTAATCCATTTAACGCTGAGTGG - Intronic
1118476324 14:66120846-66120868 TTATTCCCTGTGGTTCTGACAGG + Intergenic
1118517326 14:66544847-66544869 TTAATCCATTTAACCCTGAGTGG + Intronic
1118584837 14:67341920-67341942 TTAATCCATTTAACCCTGAGTGG - Intronic
1118773147 14:68955700-68955722 TTCATCCCAGGGATTCTGAGGGG - Intronic
1118955756 14:70478254-70478276 TTAATCCATTTAACCCTGAGTGG - Intergenic
1119591014 14:75888039-75888061 TAATACCCTCTGACTCTGAGGGG + Intronic
1119594744 14:75924542-75924564 TTAATCCATTTAACCCTGAGTGG + Intronic
1119619870 14:76124026-76124048 TTGGCCCCTGTGACTCTGACTGG + Intergenic
1119698507 14:76734239-76734261 TTAATCCATTTAACCCTGAGTGG + Intergenic
1119700513 14:76751108-76751130 TTAATCCATTTAACTCTGAGTGG - Intergenic
1119711086 14:76822457-76822479 TTAATCCATTTAACCCTGAGTGG - Intronic
1119721912 14:76897710-76897732 TTAATCCATTTAACCCTGAGTGG + Intergenic
1119835868 14:77748145-77748167 TTAATCCATTTAACCCTGAGTGG - Intronic
1119856977 14:77908229-77908251 TTAATCCTTTTGGCTCTGTGGGG + Intronic
1119868399 14:77993283-77993305 TTAATCCATTTAACCCTGAGTGG + Intergenic
1120087249 14:80287355-80287377 TTAATCCATTTAACCCTGAGTGG - Intronic
1120170470 14:81244150-81244172 TTAATCCATTTAACTCTTAGTGG + Intergenic
1120193703 14:81462150-81462172 TTAATCCATTTAACCCTGAGTGG + Intergenic
1120309697 14:82813913-82813935 TTAATCCATTTAACCCTGAGTGG + Intergenic
1120505679 14:85352297-85352319 TTAATCCATTTAACCCTGAGTGG + Intergenic
1120547481 14:85829419-85829441 TTAATCCATTTAACCCTGAGTGG + Intergenic
1121142639 14:91556792-91556814 TTAATCCATTCAACTCTGAGTGG + Intergenic
1121208217 14:92187306-92187328 TTAATCCATTTAACCCTGAGTGG + Intergenic
1121306478 14:92910971-92910993 TTAATCCATTTAACCCTGAGTGG + Intergenic
1121321236 14:92992825-92992847 TGAATCCCAGAGGCTCTGAGAGG - Intronic
1121531706 14:94658619-94658641 TTAATCCATTTAACCCTGAGTGG - Intergenic
1121623809 14:95370140-95370162 TTCTACCCTGTGACTCTGAAAGG - Intergenic
1121956074 14:98214665-98214687 TTAATCCTTGGTATTCTGAGAGG - Intergenic
1122232276 14:100312570-100312592 TTAATCCATTTAACCCTGAGTGG + Intergenic
1122497775 14:102172165-102172187 TTAATCCATTTAACCCTGAGTGG + Intronic
1122957654 14:105078860-105078882 TTAATCCATTTAACCCTGAGTGG + Intergenic
1122963460 14:105111041-105111063 TTAATCCATTTAACCCTGAGTGG + Intergenic
1202917709 14_GL000194v1_random:191211-191233 TTAATCCATTTAACCCTGAGTGG - Intergenic
1123429556 15:20203546-20203568 TTAATCCATTTAACCCTGAGTGG + Intergenic
1124132464 15:27003481-27003503 TTAATCCATTTAACCCTGAGTGG + Intronic
1124246031 15:28070898-28070920 TTAATCCATTTAACCCTGAGTGG - Intronic
1124334874 15:28849196-28849218 TTAATCCATTTAACCCTGAGTGG + Intergenic
1124814618 15:32976915-32976937 TTCATCCTTGTGACTCTGCAAGG + Intronic
1125459279 15:39893362-39893384 TTAATCCATTTAACCCTGAGTGG + Intronic
1125651635 15:41321659-41321681 TTAATCCATTTAACCCTGAGTGG - Intronic
1125659646 15:41383770-41383792 TTAATCCATTTAACCCTGAGTGG - Intergenic
1125740811 15:41963028-41963050 TTAATCCATTTAACCCTGAGTGG - Intronic
1125750125 15:42022194-42022216 TGGATCCCTGAGCCTCTGAGGGG - Intronic
1125861761 15:43005823-43005845 TTAATCCATTTAACCCTGAGTGG - Intronic
1125863028 15:43015378-43015400 TTAATCCATTTAACCCTGAGTGG - Intronic
1125868694 15:43077387-43077409 TTAATCCATTTAACCCTGAGTGG - Intronic
1126125587 15:45292668-45292690 TTAATCCATTTAACCCTGAGTGG + Intergenic
1126295900 15:47133941-47133963 TTAATCCATTTAACCCTGAGTGG - Exonic
1126516883 15:49549588-49549610 TTAATCCATTTAACCCTGAGTGG + Intronic
1126571727 15:50158840-50158862 TTAATCCATTTAACCCTGAGTGG - Intronic
1126751816 15:51885549-51885571 TTAATCCATTTAACCCTGAGTGG + Intronic
1126799569 15:52286676-52286698 TTAATCCATTTAACCCTGAGTGG - Intronic
1127073396 15:55304198-55304220 TTAATCCATTTAACCCTGAGTGG - Intronic
1127154683 15:56111383-56111405 TTAATCCATTTAACCCTGAGTGG - Intronic
1127584815 15:60368047-60368069 TTAATCCATTTAACCCTGAGTGG - Intronic
1127644794 15:60947427-60947449 TTAATCCATTTAACCCTGAGTGG - Intronic
1127769481 15:62219341-62219363 TTAATCCATTTAACCCTGAGTGG - Intergenic
1127782756 15:62331833-62331855 TTAATCCATTTAACCCTGAGTGG + Intergenic
1128071194 15:64798678-64798700 TTAATCCATTTAACCCTGAGTGG + Intergenic
1128479424 15:68024427-68024449 GTAATCCCAGCTACTCTGAGAGG + Intergenic
1128489532 15:68133993-68134015 TTAATCCATTTAACCCTGAGTGG + Intronic
1128500351 15:68222861-68222883 TTAATCCATTTAACCCTGAGTGG - Intronic
1128586741 15:68859157-68859179 TTAATCCATTTAACCCTGAGTGG + Intronic
1128597207 15:68963934-68963956 TTAATCCATTTAACCCTGAGTGG + Intronic
1128843611 15:70871212-70871234 TTAATCCATTTAACCCTGAGTGG + Intronic
1128938738 15:71769652-71769674 TTAATCCATTTAACCCTGAGTGG - Intronic
1128970693 15:72102221-72102243 TTAATCCGTTTAACCCTGAGTGG - Intronic
1129008966 15:72397380-72397402 TTAATCCATTTAACCCTGAGTGG - Intergenic
1129053936 15:72806585-72806607 TTAATCCATGTAACCCTGAGTGG + Intergenic
1129313923 15:74729555-74729577 TTAATCCCTTTAACCCTGAGTGG - Intergenic
1129428721 15:75482193-75482215 TTAATCCATTTAACCCTGAGTGG - Intronic
1129431908 15:75505193-75505215 TTAATCCATTTAACCCTGAGTGG - Intronic
1129438280 15:75559506-75559528 TTAATCCATCTAACGCTGAGTGG - Intronic
1129812221 15:78520497-78520519 TTAATCCATTTAACCCTGAGTGG + Intronic
1129889770 15:79064224-79064246 TCATTCCCTGTGGCACTGAGAGG + Intronic
1130071250 15:80648098-80648120 TTAATCCATTTAACCCTGAGTGG - Intergenic
1130144595 15:81264237-81264259 TTGGTCCCTGTAACTCAGAGAGG + Intronic
1130340527 15:82997461-82997483 TTAATCCATTTAACCCTGAGTGG + Intronic
1130428087 15:83821501-83821523 TTAATCCATTTAACCCTGAGTGG + Intronic
1130942798 15:88524684-88524706 TTAATCCATTTAACCCTGAGTGG - Intronic
1130946062 15:88551982-88552004 TTAATCCATTTAACTCTGAGTGG + Intergenic
1131001092 15:88941007-88941029 TTAATCCATTTAACCCTGAGTGG + Intergenic
1131125736 15:89855262-89855284 TTAATCCATTTAACCCTGAGTGG - Intronic
1131127718 15:89869306-89869328 TTAATCCATTTAACCCTGAGTGG - Intronic
1131141273 15:89978487-89978509 TTAATCCATTTAACTCTGAGTGG - Intergenic
1131459332 15:92607278-92607300 TTAATCCATTTAACCCTGAGTGG - Intergenic
1131479147 15:92767730-92767752 TTAATCCATTTAACCCTGAGTGG + Intronic
1132036881 15:98492654-98492676 TTAATCCATTTAACCCTGAGTGG + Intronic
1132300659 15:100773801-100773823 TTAATCCATTTAACCCTGAGTGG + Intergenic
1132992121 16:2801599-2801621 TTAATCCATTTAACCCTGAGTGG + Intergenic
1133074644 16:3271060-3271082 TTAATCCATTTAACCCTGAGTGG + Intronic
1133299615 16:4774613-4774635 TTAATCCATTTAACCCTGAGTGG + Intergenic
1133659526 16:7903013-7903035 TTAATCCATTTAACCCTGAGTGG + Intergenic
1133680528 16:8115656-8115678 TTAATCCATTTAACCCTGAGTGG - Intergenic
1133751891 16:8732480-8732502 TTAATCCATTTAACCCTGAGTGG + Intronic
1133787167 16:8982456-8982478 TTAATCCATTTAACCCTGAGTGG - Intergenic
1134032762 16:11005740-11005762 TTAATTCCTGTGAGTCGGAAGGG + Intronic
1134471746 16:14532435-14532457 TTAATCCATTTAACCCTGAGTGG + Intronic
1134750038 16:16618654-16618676 TTAATCCATTTAACCCTGAGTGG + Intergenic
1134854060 16:17505272-17505294 TTAATCCATTTAACCCTGAGTGG + Intergenic
1134995437 16:18734985-18735007 TTAATCCATTTAACCCTGAGTGG - Intergenic
1135026632 16:19003767-19003789 TTAATCCATTTAACCCTGAGTGG - Intronic
1135575713 16:23583993-23584015 TTAATCCATTTAACCCTGAGTGG - Intronic
1135694206 16:24573748-24573770 TTAATCCATTTAACCCTGAGTGG + Intergenic
1136155275 16:28377877-28377899 TTAATCCATTTAACCCTGAGTGG - Intergenic
1136160863 16:28417552-28417574 TTAATCCATTTAACCCTGAGTGG - Intergenic
1136165352 16:28449301-28449323 TTAATCCGTTTAACCCTGAGTGG - Intergenic
1136197620 16:28665719-28665741 TTAATCCGTTTAACCCTGAGTGG + Intergenic
1136202103 16:28697448-28697470 TTAATCCATTTAACCCTGAGTGG + Intronic
1136207808 16:28737412-28737434 TTAATCCATTTAACCCTGAGTGG + Intergenic
1136213959 16:28779856-28779878 TTAATCCGTTTAACCCTGAGTGG + Intergenic
1136258694 16:29059780-29059802 TTAATCCATTTAACCCTGAGTGG + Intergenic
1136426443 16:30170645-30170667 TTAATCCGTTTAACCCTGAGTGG - Intergenic
1136583723 16:31170038-31170060 TTAATCCATTTAACCCTGAGTGG - Intergenic
1136611409 16:31368866-31368888 TTAATCCATTTAACCCTGAGTGG + Intronic
1136668754 16:31837140-31837162 TTAATCCTTTTAACTCTGAGTGG - Intergenic
1136918836 16:34245365-34245387 TTAATCCATTTAACCCTGAGTGG + Intergenic
1137240672 16:46652919-46652941 TTAATCCATTTAACCCTGAGTGG + Intergenic
1137244812 16:46694118-46694140 TTAATCCATTTAACCCTGAGTGG + Intronic
1137272651 16:46912467-46912489 CAAATCCCTGGGACTCTGATTGG + Intronic
1137284120 16:47001027-47001049 TTAATCCATTTAACTCTGAGTGG - Intergenic
1137388021 16:48058796-48058818 TTAATCCATTTAACCCTGAGTGG + Intergenic
1137493688 16:48952480-48952502 TTAATCCATTTAACCCTGAGTGG - Intergenic
1137522873 16:49209914-49209936 TTAATCCATTTAACCCTGAGTGG + Intergenic
1137835445 16:51588023-51588045 TTAATCCCTCTGACTCTTTCAGG - Intergenic
1138028412 16:53539985-53540007 TTAATCCATTTAACCCTGAGTGG - Intergenic
1138043722 16:53699125-53699147 TTAATCCATTTAACCCTGAGTGG - Intronic
1138381548 16:56606376-56606398 TGAATCACTTTGACTCTGAGGGG - Intergenic
1138699180 16:58845757-58845779 TTAATCCATTTAACCCTGAGTGG + Intergenic
1138721533 16:59087821-59087843 TTTAGCCTTGTCACTCTGAGGGG + Intergenic
1139394935 16:66631666-66631688 TTAATCCATTTAACCCTGAGTGG - Intronic
1139623041 16:68163006-68163028 TTAATCCATTTAACCCTGAGTGG + Intronic
1139639147 16:68278571-68278593 TTAATCCATTTAACCCTGAGTGG + Intronic
1139771348 16:69280120-69280142 TTAATCCGTTTAACCCTGAGTGG + Intronic
1139864798 16:70052684-70052706 TTAATCCATTTAACCCTGAGTGG - Intergenic
1139885775 16:70205689-70205711 TTAATCCATTTAACCCTGAGTGG - Intergenic
1139887901 16:70224427-70224449 TTAATCCATTTAACCCTGAGTGG + Intergenic
1140063386 16:71589984-71590006 TTAATCCATTTAACCCTGAGTGG - Intergenic
1140161291 16:72497256-72497278 TTAATCCATTTAACCCTGAGTGG - Intergenic
1140904534 16:79399083-79399105 CAAATCCCTGTGACGTTGAGAGG + Intergenic
1141010115 16:80389159-80389181 TTGATGCCTGGGACTCTGTGAGG - Intergenic
1141728662 16:85807871-85807893 TTAATCCATTTAACCCTGAGTGG + Intergenic
1141941325 16:87278064-87278086 CTTACCCCTGTGAGTCTGAGAGG + Intronic
1142011879 16:87719403-87719425 TTAATCCATTTAACCCTGAGTGG - Intronic
1142332503 16:89463406-89463428 TTAATCCATTTAACCCTGAGTGG - Intronic
1142391869 16:89806608-89806630 TTAATCCATTTAACCCTGAGTGG + Intronic
1142529979 17:572764-572786 TTAATCCATTTAACCCTGAGTGG - Intronic
1142533839 17:599487-599509 TTAATCCATTTAACCCTGAGTGG - Intronic
1142634160 17:1246782-1246804 TTAATCCATTTAACCCTGAGTGG + Intergenic
1142657314 17:1402904-1402926 TTAATCCATTTAACCCTGAGTGG + Intergenic
1142818972 17:2448479-2448501 TTAATCCATTTAACCCTGAGTGG - Intronic
1142913010 17:3112096-3112118 TTAATCCATTTAACCCTGAGTGG + Intergenic
1142939489 17:3370885-3370907 TTAATCCATTTAACCCTGAGTGG + Intergenic
1142949449 17:3465515-3465537 TTAATCCATTTAACCCTGAGTGG - Intronic
1142963126 17:3563940-3563962 TTAATCCATTTAACCCTGAGTGG + Intergenic
1142974236 17:3634003-3634025 TTAATCCATTTAACCCTGAGTGG - Intronic
1143115189 17:4578068-4578090 TTAATCCATTTAACCCTGAGTGG + Intergenic
1143206491 17:5143490-5143512 TTAATCCATTTAACCCTGAGTGG - Intronic
1143277211 17:5721104-5721126 TTAATCCATTTAACCCTGAGTGG + Intergenic
1143342889 17:6226814-6226836 TTAATCCATTTAACCCTGAGTGG - Intergenic
1143667821 17:8374360-8374382 TTAATCCATTTAACCCTGAGTGG - Intronic
1143689767 17:8550876-8550898 TTAATCCATTTAACCCTGAGTGG - Intronic
1143884916 17:10057983-10058005 TTAATCCATTTAACCCTGAGTGG - Intronic
1144119988 17:12142942-12142964 TTTATGACTGTCACTCTGAGAGG - Exonic
1144482267 17:15637983-15638005 TTAATCCATTTAACTCTGAGTGG - Intronic
1144524513 17:15979247-15979269 TTAATCCATTTAACCCTGAGTGG + Intronic
1144536615 17:16096062-16096084 TTAATCCATTTAACCCTGAGTGG - Intronic
1144559665 17:16311718-16311740 TTAATCCATTTAACCCTGAGTGG + Intronic
1144716781 17:17441921-17441943 TTAATCCATTTAACCCTGAGTGG + Intergenic
1144798863 17:17911913-17911935 TTAATCCATTTAACCCTGAGTGG + Intronic
1144866495 17:18338781-18338803 TTAATCCATTTAACCCTGAGTGG - Intronic
1144934604 17:18888105-18888127 TTAATCCATTTAACCCTGAGTGG + Intronic
1145022429 17:19442144-19442166 TTAATCCATTTAACCCTGAGTGG - Intergenic
1145027174 17:19476436-19476458 TTAATCCATTTAACCCTGAGTGG - Intergenic
1145047054 17:19627382-19627404 TTAATCCATTTAACCCTGAGTGG + Intergenic
1145087219 17:19951630-19951652 TTAATCCATTTAACCCTGAGTGG - Intronic
1145206353 17:20985934-20985956 TTAATCCATTTAACCCTGAGTGG - Intergenic
1145418312 17:22741923-22741945 TTAATCCATTTAACCCTGAGTGG - Intergenic
1145684680 17:26639582-26639604 TTAATCCATTTAACCCTGAGTGG - Intergenic
1145717385 17:27034561-27034583 TTAATCCATTTAACCCTGAGTGG - Intergenic
1145733937 17:27213046-27213068 TTAATCCATCTAACCCTGAGTGG - Intergenic
1145863240 17:28225014-28225036 TTAATCCTTTTAACCCTGAGTGG - Intergenic
1145895533 17:28455669-28455691 TTAATCCATTTAACCCTGAGTGG + Intergenic
1145896286 17:28459497-28459519 TTAATCCATTTAACCCTGAGTGG - Intronic
1145920016 17:28603712-28603734 TTAATCCATTTAACCCTGAGTGG + Intronic
1146048738 17:29532604-29532626 TTAATCCATTTAACCCTGAGTGG + Intronic
1146156008 17:30523952-30523974 TTAATCCATTTAACCCTGAGTGG - Exonic
1146157594 17:30536674-30536696 TTAATCCATTTAACCCTGAGTGG + Intergenic
1146187667 17:30735986-30736008 TTAATCCATTTAACCCTGAGTGG + Intergenic
1146215763 17:30978866-30978888 TTAATCCATTTAACCCTGAGTGG + Intronic
1146271099 17:31486531-31486553 GTAATCCCAGTGCCTATGAGAGG - Intronic
1146650152 17:34601583-34601605 TTAATCACTGTCACCCTGTGTGG - Intronic
1146695750 17:34908007-34908029 TTAATCCATTTAACCCTGAGTGG - Intergenic
1146731150 17:35194737-35194759 TTAATCCATTTAACCCTGAGTGG + Intergenic
1147024313 17:37566370-37566392 TTAATCCATTTAACCCTGAGTGG - Intronic
1147109834 17:38253756-38253778 TTAATCCATTTAACCCTGAGTGG - Intergenic
1147278578 17:39338273-39338295 TTAATCCATTTAACCCTGAGTGG - Intronic
1147622456 17:41876648-41876670 TTAATCCATTTAACCCTGAGTGG - Intronic
1147709184 17:42449767-42449789 TTAATCCATTTAACCCTGAGTGG - Intergenic
1147852533 17:43452927-43452949 TTAATCCATTTAACCCTGAGTGG - Intergenic
1147974588 17:44239322-44239344 TTAATCCATTTAACCCTGAGTGG - Intergenic
1148267428 17:46237837-46237859 TTAATCCATTTAACCCTGAGTGG + Intergenic
1148269499 17:46252632-46252654 TTAATCCATTTAACCCTGAGTGG + Intergenic
1148404525 17:47398587-47398609 TTAATCCATTTAACCCTGAGTGG - Intronic
1148633017 17:49126235-49126257 TTAATCCATTTAACCCTGAGTGG - Intergenic
1148636172 17:49150658-49150680 TTAATCCATTTAACCCTGAGTGG - Intronic
1148962715 17:51406809-51406831 TTAATTCCTCTGTCTCTGTGGGG + Intergenic
1149593127 17:57846650-57846672 TTAATCCATTTAACCCTGAGTGG - Intronic
1149624783 17:58073525-58073547 TTAATCCATTTAACCCTGAGTGG + Intergenic
1149780515 17:59393772-59393794 TTAATCCATTTAACCCTGAGTGG + Intronic
1149793794 17:59500885-59500907 TTAATCCATTTAACTCTGAGTGG - Intergenic
1149909331 17:60552608-60552630 TTAATCCATTTAACCCTGAGTGG - Intergenic
1149950107 17:60976698-60976720 TTAATCCATTTAACCCTGAGTGG + Intronic
1150056352 17:62020947-62020969 TTAATCCATTTAACCCTGAGTGG + Intronic
1150061622 17:62073353-62073375 TTAATCCGTTTAACCCTGAGTGG - Intergenic
1150380699 17:64717086-64717108 TTAATCCATTTAACCCTGAGTGG - Intergenic
1150477339 17:65484971-65484993 TTAATCCATTTAACCCTGAGTGG - Intergenic
1150527528 17:65938153-65938175 TTAATCCATTTAACCCTGAGTGG - Intronic
1150557893 17:66269707-66269729 TTAATCCATTTAACCCTGAGTGG - Intergenic
1150703968 17:67470938-67470960 TTAATCCATTTAACCCTGAGTGG - Intronic
1150857289 17:68765317-68765339 GTAATTCCTGTGTCTCTGACAGG - Intergenic
1150894515 17:69195819-69195841 TTAATCCATTTAACCCTGAGTGG + Intronic
1152020440 17:77777379-77777401 TTAATCCATTTAACCCTGAGTGG - Intergenic
1152478879 17:80537107-80537129 TTAATCCATTTAACCCTGAGTGG + Intergenic
1152487131 17:80601826-80601848 TTAATCCATTTAACCCTGAGTGG + Intronic
1152672833 17:81618939-81618961 TTAATCCATTTAACCCTGAGTGG - Intronic
1153213069 18:2789295-2789317 GTAATCCCTAGCACTCTGAGAGG - Intronic
1153221633 18:2867609-2867631 TTAATCCATTTAACCCTGAGTGG + Intronic
1153243285 18:3050150-3050172 TTAATCCATTTAACCCTGAGTGG - Intergenic
1153634227 18:7099203-7099225 TTAATCCATTTAACCCTGAGTGG - Intronic
1153843008 18:9023887-9023909 TTAATCCATTTAACCCTGAGTGG + Intergenic
1154120573 18:11648453-11648475 TTAATCCATTTAACCCTGAGTGG - Intergenic
1154158313 18:11960402-11960424 TTAATCCATTTAACCCTGAGTGG - Intergenic
1154265498 18:12875043-12875065 TTAATCCATTTAACCCTGAGTGG - Intronic
1154398057 18:14010216-14010238 TTAATCCATTTAACTCTGAGTGG + Intergenic
1154990012 18:21591928-21591950 TTAATCCATTTAACCCTGAGTGG + Intronic
1155595090 18:27476598-27476620 TTAATCCATTTAACCCTGAGTGG - Intergenic
1155956825 18:31961373-31961395 TTAATCCATTTAACCCTGAGTGG - Intergenic
1156066333 18:33147628-33147650 TTAATCCATTTAACCCTGAGTGG + Intronic
1156326128 18:36077154-36077176 TTAATCCATTTAACCCTGAGTGG + Intergenic
1156596349 18:38552200-38552222 CTACTCCCTGTGACTTAGAGGGG + Intergenic
1156725799 18:40124928-40124950 ATAATCTCTGTGTCTCTCAGAGG - Intergenic
1157456023 18:47828667-47828689 TTAATCCATTTAACCCTGAGTGG - Exonic
1157629108 18:49079663-49079685 TTAATCCATTTAACCCTGAGTGG + Intronic
1157677104 18:49577276-49577298 TTAATCCATTTAACCCTGAGTGG + Intronic
1157799628 18:50608981-50609003 TTAATCCATTTAACCCTGAGTGG + Intronic
1158148927 18:54344309-54344331 TTAATCCATTTAACCCTGAGTGG - Intronic
1158366093 18:56738106-56738128 TAAATGCCTGTGACTGTAAGAGG + Intronic
1158459105 18:57632336-57632358 TTAATCCATTTAACCCTGAGTGG + Intergenic
1159157950 18:64608586-64608608 TTAATCCATTTAACCCTGAGTGG + Intergenic
1159340334 18:67126445-67126467 TTAATCCATTTAACGCTGAGTGG + Intergenic
1159614787 18:70569276-70569298 TTAATCCATTTAACCCTGAGTGG + Intergenic
1159767289 18:72505505-72505527 TTAATATCTCTGACCCTGAGAGG - Intergenic
1160108405 18:76001645-76001667 TTAATCCATTTAACCCTGAGTGG - Intergenic
1160228277 18:77028249-77028271 TTAATCCATTTAACCCTGAGTGG + Intronic
1160916394 19:1498872-1498894 TTAATCCATTTAACCCTGAGTGG + Intergenic
1161386859 19:3999181-3999203 TTAATCCATTTAACCCTGAGTGG - Intergenic
1161685993 19:5702753-5702775 TTAATCCATTTAACCCTGAGTGG - Intronic
1161790425 19:6356207-6356229 TTAATCCATTTAACCCTGAGTGG - Intergenic
1161818234 19:6513535-6513557 TTAATCCATTTAACCCTGAGTGG + Intergenic
1161947645 19:7448256-7448278 GTAATCCCTGTAACTTTGGGAGG + Intronic
1162164074 19:8740162-8740184 TTAATCCATTTAACCCTGAGTGG - Intergenic
1162255306 19:9484027-9484049 TTAATCCATTTAACCCTGAGTGG - Intronic
1162279118 19:9680660-9680682 TTAATCCATTTAACCCTGAGTGG - Intergenic
1162542107 19:11303292-11303314 TTAATCCATTTAACCCTGAGTGG - Intronic
1162651723 19:12093571-12093593 TTAATCCCAGCTACTCTGGGAGG - Intronic
1162695228 19:12468429-12468451 TTAATCCATTTAACCCTGAGTGG - Intronic
1162714601 19:12622088-12622110 TTAATCCATTTAACTCTGAGTGG - Intronic
1162887179 19:13704262-13704284 TTAATCCATTTAACCCTGAGTGG - Intergenic
1163143280 19:15363893-15363915 TTAATCCATTTAACCCTGAGTGG - Intronic
1163558328 19:18005249-18005271 TTAATCCATTTAACCCTGAGTGG + Intronic
1163780586 19:19245200-19245222 TGAATCCCTGTGAGTTTGAGGGG + Intronic
1163896331 19:20063781-20063803 TTAATCCATTTAACCCTGAGTGG + Intergenic
1163904399 19:20138344-20138366 TTAATCCATTTAACCCTGAGTGG - Intergenic
1163905516 19:20149032-20149054 TTAATCCATTTAACCCTGAGTGG + Intergenic
1163906350 19:20152292-20152314 TTAATCCATTTAACCCTGAGTGG + Intergenic
1163909305 19:20175590-20175612 TTAATCCATTTAACACTGAGTGG + Intronic
1163913224 19:20215028-20215050 TTAATCCATTTAACCCTGAGTGG - Intergenic
1163921881 19:20296950-20296972 TTAATCCATTTAACCCTGAGTGG - Intergenic
1163945090 19:20529340-20529362 TTAATCCATTTAACCCTGAGTGG + Intergenic
1163986021 19:20952309-20952331 TTAATCCATTTAACCCTGAGTGG + Intergenic
1163996036 19:21048443-21048465 TTAATCCATTTAACCCTGAGTGG + Intronic
1164012031 19:21212219-21212241 TTAATCCATTTAACCCTGAGTGG + Intergenic
1164034667 19:21443241-21443263 TTAATCCATTTAACCCTGAGTGG + Intronic
1164040113 19:21486584-21486606 TTAATCCATTTAACCCTGAGTGG + Intronic
1164043076 19:21510839-21510861 TTAATCCATTTTACCCTGAGTGG + Intronic
1164053975 19:21606776-21606798 TTAATCCATTTAACCCTGAGTGG + Intergenic
1164055066 19:21615271-21615293 TTAATCCATTTAACCCTGAGTGG - Intergenic
1164065124 19:21708426-21708448 TTAATCCATTTAACCCTGAGTGG - Intergenic
1164066930 19:21722443-21722465 TTAATCCATTTAACCCTGAGTGG - Intergenic
1164071933 19:21776385-21776407 TTAATCCATTTAACCCTGAGTGG - Intergenic
1164081434 19:21865004-21865026 TTAATCCATTTAACCCTGAGTGG + Intergenic
1164105442 19:22105773-22105795 TTAATCCATTTAACCCTGAGTGG - Intergenic
1164105512 19:22106367-22106389 TTAATCCATTTAACCCTGAGTGG + Intergenic
1164126181 19:22321331-22321353 TTAATCCATTTAACCCTGAGTGG + Intergenic
1164153650 19:22575104-22575126 TTAATCCATTTAACCCTGAGTGG - Intergenic
1164167993 19:22700055-22700077 TTAATCCATTTAACCCTGAGTGG + Intergenic
1164186046 19:22871110-22871132 TTAATCCATTTAACCCTGAGTGG + Intergenic
1164192978 19:22928322-22928344 TTAATCCATTTAACCCTGAGTGG - Intergenic
1164214842 19:23134960-23134982 TTAATCCATTTAACCCTGAGTGG - Intronic
1164218762 19:23173753-23173775 TTAATCCATTTAACCCTGAGTGG - Intergenic
1164231086 19:23289627-23289649 TTAATCCATTTAACCCTGAGTGG + Intergenic
1164238841 19:23365826-23365848 TTAATCCATTTAACCCTGAGTGG + Intronic
1164239334 19:23369740-23369762 TTAATCCATTTAACCCTGAGTGG - Intronic
1164244848 19:23419972-23419994 TTAATCCATTTAACCCTGAGTGG - Intergenic
1164256510 19:23533096-23533118 TTAATCCATTTAACCCTGAGTGG + Intronic
1164301381 19:23964858-23964880 TTAATCCATTTAACCCTGAGTGG - Intergenic
1164424679 19:28130796-28130818 TTAATCCATTTAACCCTGAGTGG - Intergenic
1164652121 19:29898598-29898620 TTAATCCATTTAACCCTGAGTGG + Intergenic
1164659151 19:29948601-29948623 TTAATCCATTTAACCCTGAGTGG + Intronic
1165192704 19:34078747-34078769 TTAATCCATTTAACCCTGAGTGG + Intergenic
1165199650 19:34133455-34133477 TTAATCCATTTAACCCTGAGTGG - Intergenic
1165541031 19:36491879-36491901 TTAATCCATTTAACCCTGAGTGG - Intergenic
1165768182 19:38363723-38363745 TTAATCCATTTAACCCTGAGTGG + Intronic
1165842450 19:38797386-38797408 TTAATCCATTTAACCCTGAGTGG + Intergenic
1165851950 19:38855229-38855251 TTAATCCATTTAACTCTGAGTGG + Intergenic
1165883306 19:39058794-39058816 TTAATCCATTTAACCCTGAGTGG + Intergenic
1166028082 19:40107475-40107497 TTAATCCATTTAACCCTGAGTGG + Intergenic
1166030187 19:40119101-40119123 TTAATCCATTTAACCCTGAGTGG - Intergenic
1166180478 19:41103973-41103995 TTAATCCATTTAACCCTGAGTGG - Intergenic
1166192095 19:41181560-41181582 TTAATCCATTTAACCCTGAGTGG - Intergenic
1166261868 19:41645593-41645615 TTAATCCATTTAACCCTGAGTGG - Intronic
1166277944 19:41768358-41768380 TTAATCCATTTAACCCTGAGTGG + Intronic
1166417838 19:42609924-42609946 TTAATCCATTTAACCCTGAGTGG + Intronic
1166532052 19:43548508-43548530 TTAATCCATTTAACCCTGAGTGG - Intronic
1166640344 19:44489474-44489496 TTAATCCATTTAACCCTGAGTGG - Intronic
1166708323 19:44921371-44921393 TTAATCCATTTAACCCTGAGTGG + Intergenic
1167038911 19:47010347-47010369 TTAATCCATTTAACCCTGAGTGG - Intergenic
1167331242 19:48857650-48857672 TTAATCCATTTAACCCTGAGTGG - Intronic
1167336543 19:48889802-48889824 TTAATCCATTTAACCCTGAGTGG - Intronic
1167541035 19:50087066-50087088 TTAATCCATTTAACCCTGAGTGG - Intergenic
1167548223 19:50141599-50141621 TTAATCCATTTAACCCTGAGTGG - Intergenic
1167588710 19:50390835-50390857 TTAATCCATTTAACCCTGAGTGG + Intronic
1167624980 19:50582099-50582121 TTAATCCATTTAACCCTGAGTGG + Intergenic
1167823822 19:51953373-51953395 TTAATCCATTTAACCCTGAGTGG - Intergenic
1167876954 19:52421736-52421758 TTAATCCATTTAACCCTGAGTGG + Intergenic
1167907873 19:52676862-52676884 TTAATCCATTTAACCCTGAGTGG - Intronic
1167910551 19:52698518-52698540 TTAATCCATTTAACCCTGAGTGG + Intergenic
1167924773 19:52812501-52812523 TTAATCCATTTAACCCTGAGTGG - Intronic
1167937585 19:52920425-52920447 TTAATCCATTTAACCCTGAGTGG - Intergenic
1167958160 19:53084659-53084681 TTATTCCTTGTGAGTCTGAGTGG - Intronic
1167970440 19:53186207-53186229 TTAATCCATTTAACCCTGAGTGG + Intronic
1167975587 19:53223368-53223390 TTAATCCATTTAACCCTGAGTGG - Intergenic
1167980206 19:53269645-53269667 TTAATCCATTTAACCCTGAGTGG + Intergenic
1168017787 19:53587339-53587361 TTAATCCATTTAACCCTGAGTGG - Intergenic
1168052327 19:53838792-53838814 TTAATCCATTTAACCCTGAGTGG - Intergenic
1168114532 19:54214537-54214559 TTAATCCATTTAACCCTGAGTGG + Intronic
1168213413 19:54908247-54908269 TTAATCCATTTAACCCTGAGTGG + Intronic
1168219612 19:54951061-54951083 TTAATCCATTTAACCCTGAGTGG + Intronic
1168226458 19:54998891-54998913 TTAATCCGTTTAACTCTGAGTGG + Intronic
1168658563 19:58148127-58148149 TTAATCCATTTAACCCTGAGTGG - Intronic
924971079 2:127364-127386 TTAATCCATTTAACCCTGAGTGG - Intergenic
925336882 2:3105235-3105257 TTAATCCATTTAACCCTGAGTGG + Intergenic
925373615 2:3365745-3365767 TTAATCCATTTAACCCTGAGTGG + Intronic
925400381 2:3568762-3568784 TTAATCCATTTAACCCTGAGTGG + Intergenic
925407408 2:3615398-3615420 TTAATCCATTTAACCCTGAGTGG + Intronic
925513714 2:4656348-4656370 TTAATCTCTGTGACTCTGATGGG - Intergenic
925773710 2:7310591-7310613 TTAATCCCTGTGTCTCACAATGG + Intergenic
925776122 2:7337976-7337998 TTAATCCATTTAACCCTGAGTGG + Intergenic
926215219 2:10902208-10902230 TTAATCCATTTAACCCTGAGTGG + Intergenic
926252661 2:11164796-11164818 TTAATCCATTTAACCCTGAGTGG + Intronic
926322531 2:11759441-11759463 TTAATCCATTTAACCCTGAGTGG + Intronic
926639405 2:15219583-15219605 TTAATCCATTTAACCCTGAGTGG + Intronic
926667661 2:15542363-15542385 TTAATCCATTTAACCCTGAGTGG - Intronic
926674655 2:15611143-15611165 TTAATCCATTTAACCCTGAGTGG + Intronic
926790374 2:16565302-16565324 TTAATCCCTGCTACTTTGGGAGG - Intronic
926872453 2:17437825-17437847 TTAATCTGTGTGACTTTGGGTGG - Intergenic
927737103 2:25534263-25534285 TTAATCCATTTAACCCTGAGTGG + Intronic
927738089 2:25540777-25540799 TTAATCCATTTAACCCTGAGTGG - Intronic
927747521 2:25634792-25634814 TTAATCCATTTAACCCTGAGTGG - Intronic
927776774 2:25909984-25910006 TTAATCCATTTAACCCTGAGTGG + Intergenic
927832967 2:26370117-26370139 TTAATCCATTTAACTCTGAGTGG + Intronic
927877063 2:26665129-26665151 TTAATCCATTTAACCCTGAGTGG + Intergenic
927897630 2:26794958-26794980 TTAATCCATTTAACCCTGAGTGG + Intronic
927978847 2:27359975-27359997 TTAATCCATTTAACCCTGAGTGG - Intergenic
927992804 2:27460145-27460167 TTAATCCATTCAACTCTGAGTGG - Intronic
928002780 2:27539375-27539397 TTAATCCATTTAACCCTGAGTGG + Intronic
928005024 2:27556971-27556993 TTAATCCATTTAACCCTGAGTGG + Intronic
928531852 2:32200589-32200611 TTAATCCATTTAACCCTGAGTGG - Intronic
928557811 2:32447011-32447033 TTAATCCATTTAACCCTGAGTGG + Intronic
928585397 2:32754403-32754425 TTAATCCATTTAACCCTGAGTGG + Intronic
928597551 2:32870268-32870290 TTAATCCATTTAACCCTGAGTGG - Intergenic
928687114 2:33761123-33761145 TTAATCCATTTAACCCTGAGTGG + Intergenic
928722078 2:34132774-34132796 TTAATCCGTTTAACCCTGAGTGG + Intergenic
928990203 2:37225484-37225506 TTAATCCATTCAACTCTGAGTGG - Intronic
929064904 2:37963576-37963598 TTAATCCATTTAACCCTGAGTGG + Intronic
929110871 2:38404116-38404138 TTAATCCATTTAACCCTGAGTGG - Intergenic
929151796 2:38755512-38755534 TTAATCCATTTAACCCTGAGTGG + Intronic
929238134 2:39627782-39627804 TTAATCCATTTAACTCTGAGTGG + Intergenic
929416601 2:41748432-41748454 TTAATCCATTTAACCCTGAGTGG - Intergenic
929445247 2:41995915-41995937 TTAATCCATTTAACCCTGAGTGG - Intergenic
929447602 2:42013989-42014011 TTAATCCATTTAACTCTGAGTGG + Intergenic
929515720 2:42604842-42604864 TTAATCCATTTAACCCTGAGTGG + Intronic
929517867 2:42621390-42621412 TTAATCCATTTAACCCTGAGTGG + Intronic
929577648 2:43062776-43062798 TTAATCCATTTAACTCTGAGTGG + Intergenic
929614857 2:43298333-43298355 TTAATCCATTTAACCCTGAGTGG - Intronic
929650663 2:43677457-43677479 TTAATCCATTTAACCCTGAGTGG + Intronic
929689986 2:44066605-44066627 TTAATCCATGTAACCCTGAGTGG + Intergenic
929740040 2:44589620-44589642 TTAATCCATGTAACCCTGAGTGG - Intronic
930201409 2:48554985-48555007 TTAATCCATTTAACCCTGAGTGG + Intronic
930208657 2:48614093-48614115 TTAATCCATTTAACCCTGAGTGG + Intronic
930301464 2:49621153-49621175 TTATTTCCTGGGATTCTGAGAGG - Intergenic
930590710 2:53323258-53323280 TTAATCCATTTAACCCTGAGTGG + Intergenic
930665248 2:54095145-54095167 TTAATCCATTTAACCCTGAGTGG + Intronic
930727981 2:54699547-54699569 TTAATCCATTTAACCCTGAGTGG - Intergenic
930827205 2:55706147-55706169 TTAATCCATTTAACCCTGAGTGG - Intergenic
930833714 2:55773193-55773215 TTAATCCATTTAACCCTGAGTGG + Intergenic
931458559 2:62431559-62431581 ATAATCCCTGGTCCTCTGAGTGG - Intergenic
931480092 2:62630942-62630964 TTAATCCATTTAACCCTGAGTGG - Intergenic
931584392 2:63809647-63809669 TTAATCCATTTAACCCTGAGTGG - Intronic
931604743 2:64041588-64041610 TTAATCCATTTAACCCTGAGTGG + Intergenic
931655871 2:64511207-64511229 TTAATCCATTTAACCCTGAGTGG + Intergenic
931752200 2:65339461-65339483 TTAATCCATTTAACCCTGAGTGG - Intronic
932367440 2:71161815-71161837 TTAATCCATTTAACCCTGAGTGG - Intergenic
932410148 2:71542632-71542654 TTAATCCATTTAACCCTGAGTGG + Intronic
932710521 2:74060783-74060805 TTAATCCATTTAACCCTGAGTGG + Intronic
932719134 2:74124660-74124682 TTAATCCATTTAACCCTGAGTGG - Intergenic
932807238 2:74795357-74795379 TTAATCCATTTAACCCTGAGTGG + Intergenic
932903505 2:75725524-75725546 TTAATCCATTTAACCCTGAGTGG - Intergenic
934309940 2:91852716-91852738 TTAATCCATTTAACCCTGAGTGG - Intergenic
934703916 2:96462837-96462859 TTAATCCATTTAACCCTGAGTGG - Intergenic
934752918 2:96805706-96805728 TTAATCCATTTAACCCTGAGTGG + Intronic
934897393 2:98130647-98130669 TTAATCCATTTAACCCTGAGTGG + Intronic
935630377 2:105209924-105209946 TTAATCCATTTAACCCTGAGTGG + Intergenic
935935730 2:108181099-108181121 TTGATCCGTGTGACTTCGAGTGG - Intergenic
936158169 2:110063658-110063680 TTAATCCATTTAACCCTGAGTGG + Intergenic
936186522 2:110307784-110307806 TTAATCCATTTAACCCTGAGTGG - Intergenic
936345701 2:111673209-111673231 TTAATCCATTTAACCCTGAGTGG - Intergenic
936486972 2:112934422-112934444 TTAATCCATTTAACCCTGAGTGG - Intergenic
936504640 2:113096119-113096141 TTAATCCATTTAACCCTGAGTGG + Intergenic
936546668 2:113395740-113395762 TTAATCCATTTAACCCTGAGTGG - Intergenic
937437798 2:121893508-121893530 TTAATCCATTTAACCCTGAGTGG - Intergenic
937734826 2:125276837-125276859 TTAATCCATTTAACCCTGAGTGG + Intergenic
937919282 2:127119159-127119181 TTAATCCATTTAACCCTGAGTGG + Intergenic
937947621 2:127353978-127354000 TTAATCCATTTAACCCTGAGTGG - Intronic
938005478 2:127787116-127787138 TTAATCCATTTAACCCTGAGTGG + Intronic
938088552 2:128417836-128417858 TTAATCCATTTAACCCTGAGTGG + Intergenic
938250052 2:129807809-129807831 TTAATCCATCTAACCCTGAGTGG + Intergenic
938253501 2:129834047-129834069 TTAATCCATTTAACCCTGAGTGG - Intergenic
938534341 2:132222571-132222593 TTAATCCATTTAACACTGAGTGG - Intronic
938828712 2:135032872-135032894 TTAATCCATTTAACCCTGAGTGG + Intronic
938836350 2:135106488-135106510 TTAATCCATTTAACCCTGAGTGG - Intronic
938852404 2:135274884-135274906 TTAATCCATTTAACCCTGAGTGG + Intronic
938891109 2:135706636-135706658 TTAATCCATTTAACCCTGAGTGG + Intronic
939477375 2:142703035-142703057 TTAATCCATTTAACCCTGAGTGG - Intergenic
939578309 2:143921566-143921588 TTAATCCATTTAACCCTGAGTGG + Intergenic
939584902 2:143992270-143992292 TTAATCCATTTAACCCTGAGTGG - Intronic
940269440 2:151875252-151875274 TTAATCCATTTAACCCTGAGTGG + Intronic
940635698 2:156294048-156294070 TTAATCCATTTAACCCTGAGTGG - Intergenic
940643847 2:156369862-156369884 TTAATCCATTTAACCCTGAGTGG - Intergenic
940652117 2:156450922-156450944 TTAATCCATTTAACCCTGAGTGG + Intronic
940817166 2:158310183-158310205 TTAATCCATTTAACCCTGAGTGG + Intronic
941025235 2:160449561-160449583 TTAATCCGTTTAACCCTGAGTGG - Intronic
941197715 2:162470981-162471003 TTAATCCATTTAACCCTGAGTGG - Intronic
941637725 2:167953691-167953713 TTAGTCCCTGAGGCTCAGAGTGG - Intergenic
941793133 2:169574779-169574801 TTAATCCATTTAACCCTGAGTGG + Intergenic
941814330 2:169785285-169785307 TTAATCCATTTAACCCTGAGTGG + Intergenic
941848003 2:170150640-170150662 TTAATCCATTTAACCCTGAGTGG - Intergenic
942020774 2:171866101-171866123 TTAATCCATTTAACCCTGAGTGG + Intronic
942024914 2:171900692-171900714 TTAATCCATTTAACCCTGAGTGG - Intronic
942096452 2:172538797-172538819 TTAATCCATTTAACCCTGAGTGG - Intergenic
942355842 2:175108907-175108929 TTAATCCATTTAACCCTGAGTGG - Intronic
942505645 2:176638485-176638507 TAAATCCCCGTGACCCTGATTGG + Intergenic
942620924 2:177844797-177844819 TTAATCCATTTAACCCTGAGTGG + Intronic
942753990 2:179319213-179319235 TTAATCCATTTAACCCTGAGTGG + Intergenic
943005919 2:182387153-182387175 TTAATCCATTTAACCCTGAGTGG - Intronic
943100448 2:183479735-183479757 TTAATCCATTTAACCCTGAGTGG - Intergenic
943297000 2:186153589-186153611 TTAATCCATTTAACCCTGAGTGG + Intergenic
943323748 2:186473931-186473953 TTAATCCATTTAACTCTGAGTGG - Intergenic
943648203 2:190430464-190430486 TTAATCCATTTAACCCTGAGTGG + Intronic
943721224 2:191205398-191205420 TTAATCCATTTAACCCTGAGTGG - Intergenic
943739668 2:191397451-191397473 TTAATCCATTTAACCCTGAGTGG + Intronic
943745338 2:191456344-191456366 TTAATCCATTTAACCCTGAGTGG + Intergenic
943784017 2:191856700-191856722 TTAGACCATGTGACTCTGGGAGG - Intergenic
944061042 2:195568911-195568933 TTAATCCATTTAACCCTGAGTGG - Intergenic
944262832 2:197695690-197695712 TTAATCCATTTAACCCTGAGTGG + Intronic
944283181 2:197922271-197922293 TTAATCCATTTAACCCTGAGTGG + Intronic
944532670 2:200682885-200682907 TTAATCCATTTAACCCTGAGTGG + Intergenic
944585019 2:201165840-201165862 TTAATCCATTTAACCCTGAGTGG + Exonic
944598234 2:201282195-201282217 TTAATCCATTTAACCCTGAGTGG + Intronic
944625145 2:201562774-201562796 TTAATCCATTTAACCCTGAGTGG + Intronic
944722635 2:202439979-202440001 TTAATCCATTTAACCCTGAGTGG + Intronic
944732799 2:202534518-202534540 TTAATCCATTTAACCCTGAGTGG + Intronic
944737253 2:202578222-202578244 TTAATCCATTTAACCCTGAGTGG - Intergenic
944751425 2:202714791-202714813 TTAATCCATTTAACCCTGAGTGG + Intronic
944798063 2:203207648-203207670 TTAATCCATTTAACCCTGAGTGG - Intronic
944815439 2:203372187-203372209 TTAATCCATTTAACCCTGAGTGG + Intronic
944869947 2:203899987-203900009 TTAATCTCTTGGATTCTGAGTGG - Intergenic
945090201 2:206171222-206171244 TTAATCCATTTAACCCTGAGTGG + Intergenic
945110211 2:206355808-206355830 TTAATCCATTTAACCCTGAGTGG + Intergenic
945114730 2:206400268-206400290 TTAATCCATTTAACCCTGAGTGG + Intergenic
945233372 2:207611755-207611777 TTAATCCATTTAACCCTGAGTGG - Exonic
945316525 2:208377131-208377153 TTAATCCATTTAACCCTGAGTGG + Intronic
945530921 2:210951323-210951345 TTAATCCATTTAACCCTGAGTGG - Intergenic
945835454 2:214834556-214834578 TTAATCCATTTAACCCTGAGTGG + Intergenic
945864706 2:215162994-215163016 TTAATCCATTTAACCCTGAGTGG + Intergenic
945969971 2:216225500-216225522 TTAATCCATTTAACCCTGAGTGG + Intergenic
946240035 2:218348529-218348551 TTAATCCATTTAACCCTGAGTGG + Intergenic
946304390 2:218847313-218847335 TTAATCCATTTAACCCTGAGTGG - Intergenic
946750914 2:222895738-222895760 TTAATCCATTTAACCCTGAGTGG + Intronic
947402675 2:229743863-229743885 TTAATCCATTTAACCCTGAGTGG - Intergenic
947562047 2:231163412-231163434 TTAATCTCTGTGCCTTTGAATGG - Intronic
947798189 2:232906917-232906939 TTAATCCATTTAACCCTGAGTGG - Intronic
947901205 2:233723789-233723811 TTAATCCATTTAACCCTGAGTGG + Intronic
948000550 2:234563349-234563371 TTAATCCATTTAACCCTGAGTGG - Intergenic
948589094 2:239038169-239038191 TTAATCCATTTAACCCTGAGTGG + Intergenic
948651556 2:239449197-239449219 TTAATCCATTTAACCCTGAGTGG + Intergenic
948706514 2:239796353-239796375 TTAATCCATTTAACCCTGAGTGG - Intronic
948718504 2:239881457-239881479 TCAAGCCCTGTGACCCTGTGCGG + Intergenic
948741141 2:240046679-240046701 CTTATCCCTGTCAATCTGAGGGG + Intergenic
949076429 2:242061716-242061738 TTAATCCATTTAACTCTGAGTGG + Intergenic
1169086275 20:2825477-2825499 TTAATCCATCTAACCCTGAGTGG - Intergenic
1169167917 20:3440691-3440713 TTAATCCATTTAACCCTGAGTGG + Intergenic
1169371071 20:5028389-5028411 TTAATCCATTTAACCCTGAGTGG - Intergenic
1169441680 20:5638927-5638949 TTAATCCATTTAACCCTGAGTGG + Intergenic
1169449970 20:5702459-5702481 TTAATCCATTTAACCCTGAGTGG - Intergenic
1169718405 20:8645053-8645075 TTAATCCATTTAACCCTGAGTGG - Intronic
1169885502 20:10394562-10394584 TTAATCCATTTAACCCTGAGTGG + Intergenic
1169991817 20:11513068-11513090 TTAATCCATTTAACCCTGAGTGG + Intergenic
1170202685 20:13761116-13761138 TTAATCCATTTAACCCTGAGTGG - Intronic
1170384049 20:15796606-15796628 ATAATCCCTGTTTCTCAGAGGGG - Intronic
1170424637 20:16226796-16226818 TTAATCCATTTAACCCTGAGTGG + Intergenic
1170592260 20:17779597-17779619 TTAATCCATTTAACCCTGAGTGG - Intergenic
1170622840 20:18009848-18009870 TTAATCCATTTAACCCTGAGTGG + Intronic
1170645851 20:18195111-18195133 TTAATCCATTTAACCCTGAGTGG - Intergenic
1170664489 20:18375340-18375362 TTAATCCATTTAACCCTGAGTGG + Intergenic
1170677418 20:18495323-18495345 TTAATCCATTTAACCCTGAGTGG - Intronic
1170811380 20:19677965-19677987 TTAATCCATTTAACCCTGAGTGG + Intronic
1171365936 20:24625622-24625644 TTAATCCATTTAACCCTGAGTGG + Intronic
1171463754 20:25313318-25313340 TTAATCCATTTAACCCTGAGTGG - Intronic
1171497052 20:25562530-25562552 TTAATCCATTTAACCCTGAGTGG - Intronic
1171848297 20:30291241-30291263 TTAATCCATTTAACCCTGAGTGG + Intergenic
1171861716 20:30406338-30406360 TTAATCCATTTAACCCTGAGTGG - Intergenic
1171899738 20:30846604-30846626 TTAATCCATTTAACACTGAGTGG + Intergenic
1171952014 20:31428156-31428178 TTAATCCATTTAACCCTGAGTGG - Intergenic
1171956746 20:31469707-31469729 TTAATCCATTTAACCCTGAGTGG + Intronic
1172051294 20:32121461-32121483 TTAATCCATTTAACTCTGAGTGG + Intronic
1172141421 20:32724676-32724698 TTAATCCATTTAACCCTGAGTGG - Intronic
1172196045 20:33092329-33092351 TTAAACCCACTGAGTCTGAGTGG - Intronic
1172199736 20:33116197-33116219 TTAATCCATTTAACCCTGAGTGG - Intergenic
1172209013 20:33184772-33184794 TTAATCCATTTAACCCTGAGTGG + Intergenic
1172234776 20:33364307-33364329 GTAATCCCAGTGACTTTGGGAGG - Intronic
1172348702 20:34223954-34223976 TTAATCCATTTAACCCTGAGTGG - Intronic
1172349156 20:34228843-34228865 TTAATCCATTTAACCCTGAGTGG + Intronic
1172402304 20:34659787-34659809 TTAATCCATTTAACCCTGAGTGG - Intronic
1172465980 20:35154783-35154805 TTAATCCATTTAACCCTGAGTGG - Intergenic
1172574867 20:36001006-36001028 TTAATCCATTTAACCCTGAGTGG + Intronic
1172717451 20:36975986-36976008 TTAATCCATTTAACCCTGAGTGG + Intergenic
1172723004 20:37013324-37013346 TTAATCCATTTAACCCTGAGTGG - Intronic
1172729051 20:37070205-37070227 TTAATCCATTTAACCCTGAGTGG - Intronic
1172918282 20:38460904-38460926 TTAATCCATTTAACCCTGAGTGG + Intergenic
1173163718 20:40671423-40671445 TAACTCCATGTGACTGTGAGTGG - Intergenic
1173272888 20:41554649-41554671 TTAATCCATTTAACCCTGAGTGG + Intronic
1173508294 20:43606845-43606867 TTAATCCATTTAACCCTGAGTGG + Intronic
1173517909 20:43678038-43678060 TTAATCCATTTAACCCTGAGTGG - Intronic
1173566961 20:44047580-44047602 TTAATCCATTTAACCCTGAGTGG - Intronic
1173769369 20:45645279-45645301 TTAATCCATTTAACCCTGAGTGG + Intergenic
1174015163 20:47481922-47481944 ATAACCCCTGTGACTGTGTGGGG - Intergenic
1174206421 20:48843343-48843365 TCAATCACTATGACTCTGAATGG + Intergenic
1174376290 20:50128768-50128790 CTAGTCCCTTTGCCTCTGAGTGG - Intronic
1174763241 20:53227524-53227546 TTTATCCATGTCACTCTGATAGG - Intronic
1174878172 20:54250016-54250038 TTAATCCATTTAACCCTGAGTGG + Intergenic
1175361079 20:58413407-58413429 TTAATCCATTTAACCCTGAGTGG + Intronic
1175775810 20:61653195-61653217 TTAATCCATTTAACCCTGAGTGG + Intronic
1176838727 21:13820046-13820068 TTAATCCATTTAACCCTGAGTGG - Intergenic
1176888191 21:14281724-14281746 TTAATCCATTTAACCCTGAGTGG + Intergenic
1177005957 21:15672453-15672475 TTAATCCATTTAACCCTGAGTGG + Intergenic
1177134044 21:17291769-17291791 TTAATCCATTTAACCCTGAGTGG + Intergenic
1177177833 21:17718903-17718925 TTAATCCATTTAACCCTGAGTGG + Intergenic
1177788196 21:25695239-25695261 TTAATCCATTTAACCCTGAGTGG + Intronic
1178034523 21:28564524-28564546 TTAATCCATTCAACTCTGAGTGG - Intergenic
1178743520 21:35225880-35225902 TTACTCACAGTGGCTCTGAGGGG + Intronic
1178812769 21:35898344-35898366 TTAATCCATTTAACCCTGAGTGG - Intronic
1179195369 21:39157937-39157959 TTAATCCATTTAACCCTGAGTGG - Intergenic
1179412340 21:41171415-41171437 TAAAGCCCAGTGACTCTGTGAGG + Intronic
1179444487 21:41421648-41421670 TTAATCCATTTAACCCTGAGTGG + Intronic
1179589385 21:42396222-42396244 TCATTCCCTGTAACTCTGAGAGG + Exonic
1179803445 21:43822765-43822787 TTAATCCATTTAACCCTGAGTGG - Intergenic
1179814566 21:43897216-43897238 TTAATCCATTTAACCCTGAGTGG + Intronic
1179969440 21:44825671-44825693 TTAATCCATTTAACCCTGAGTGG - Intergenic
1180039738 21:45269523-45269545 TTAATCCATTTAACCCTGAGTGG - Intronic
1180125291 21:45785868-45785890 TTAATCCATTTAACCCTGAGTGG - Intronic
1180672204 22:17561766-17561788 TTAATCCATTTAACCCTGAGTGG - Intergenic
1180739146 22:18041172-18041194 TTAATCCATTTAACCCTGAGTGG + Intergenic
1181297096 22:21848167-21848189 TTAATCCATTTAACCCTGAGTGG - Intronic
1181301272 22:21883197-21883219 TTAATCCATTTAACCCTGAGTGG + Intergenic
1181374204 22:22442351-22442373 TTAATCCATTTAACCCTGAGTGG - Intergenic
1181538517 22:23560736-23560758 TTAATCCATTTAACCCTGAGTGG + Intergenic
1181586656 22:23856019-23856041 TTAATCCATTTAACCCTGAGTGG - Intergenic
1181594804 22:23907250-23907272 TTAATCCATTTAACCCTGAGTGG - Intergenic
1181599002 22:23937629-23937651 TTAATCCATTTAACCCTGAGTGG - Intergenic
1181617446 22:24064775-24064797 TTAATCCATTTAACCCTGAGTGG + Intronic
1181657586 22:24316537-24316559 TTAATCCATTTAACCCTGAGTGG + Intronic
1181792205 22:25277392-25277414 TTAATCCATTTAACCCTGAGTGG + Intergenic
1181981811 22:26772407-26772429 TTAATCCATTTAACCCTGAGTGG + Intergenic
1182199522 22:28554109-28554131 TTAATCCATTTAACCCTGAGTGG - Intronic
1182331267 22:29552974-29552996 TTAATCCATTTAACCCTGAGTGG - Intronic
1182343454 22:29643549-29643571 TTAATCCATTTAACCCTGAGTGG + Intronic
1182399038 22:30060188-30060210 TTAATCCATTTAACCCTGAGTGG - Intergenic
1182399921 22:30067244-30067266 TTAATCCATTTAACCCTGAGTGG - Intergenic
1182484444 22:30631262-30631284 TTAATCCATTTAACCCTGAGTGG + Intergenic
1182510037 22:30812782-30812804 TTACTCCTTGTTACTCTGATGGG + Intronic
1182539260 22:31028085-31028107 TTAATCCATTTAACCCTGAGTGG - Intergenic
1182616047 22:31591226-31591248 TTGATCCATTTAACTCTGAGTGG + Intronic
1182770246 22:32789990-32790012 TTATTCCTTGTAACTCTGTGAGG + Intronic
1182982293 22:34683949-34683971 TTAATCCATTTAACCCTGAGTGG + Intergenic
1183059207 22:35325368-35325390 GTAATATCTGTAACTCTGAGGGG - Intronic
1183185908 22:36291414-36291436 TTAATCCATTTAACCCTGAGTGG - Intronic
1183434835 22:37787335-37787357 TTAATCCATTTAACCCTGAGTGG - Intergenic
1183537119 22:38409658-38409680 TTAATCCATTTAACCCTGAGTGG + Intergenic
1183595640 22:38808271-38808293 TTAATCCATTTAACCCTGAGTGG - Intergenic
1183840921 22:40500652-40500674 TTAATCCATTTAACCCTGAGTGG + Intronic
1183845742 22:40538303-40538325 TTAATCCATTTAACCCTGAGTGG - Intronic
1183871287 22:40744412-40744434 TTAATCCATTTAACCCTGAGTGG + Intergenic
1184169378 22:42750210-42750232 TTAATCCATTTAACTCTGAGTGG + Intergenic
1184201488 22:42972241-42972263 TTAATCCATTTAACCCTGAGTGG - Intronic
1185188248 22:49416189-49416211 TTAATCCATTTAACCCTGAGTGG - Intronic
1185283694 22:49989608-49989630 TTAATCCATTTAACCCTGAGTGG + Intergenic
949330409 3:2916461-2916483 TTAATCCATTTAACCCTGAGTGG + Intronic
949551061 3:5113470-5113492 TTAATCCATTTAACCCTGAGTGG + Intergenic
949565640 3:5242632-5242654 TTAATCCATTTAACCCTGAGTGG + Intergenic
949569872 3:5283481-5283503 TTAATCCATTTAACCCTGAGTGG + Intergenic
949619720 3:5796770-5796792 TTATTCCTTGTGACTCCGAGTGG - Intergenic
949648691 3:6129379-6129401 TTAATCCATTTAACCCTGAGTGG + Intergenic
949853690 3:8440958-8440980 TTAATCCATTTAACCCTGAGTGG - Intergenic
949952550 3:9241178-9241200 GTGATCCCTGTAACTCTGTGAGG - Intronic
949989964 3:9570470-9570492 TTAATCCATTTAACCCTGAGTGG - Intergenic
950030425 3:9848461-9848483 TTAATCCATTTAACCCTGAGTGG + Intronic
950044184 3:9939591-9939613 TTAATCCATTTAACCCTGAGTGG + Intronic
950061010 3:10070864-10070886 TTAATCCATTTAACCCTGAGTGG - Intronic
950185381 3:10941999-10942021 GCAATCCCTGTGGCTCTGTGAGG - Intergenic
950253509 3:11487093-11487115 TTAATCCATTTAACCCTGAGTGG + Intronic
950412606 3:12849296-12849318 TTAATCCATTTAACCCTGAGTGG + Intronic
950742674 3:15062804-15062826 TTAATCCATTTAACCCTGAGTGG - Intronic
950754534 3:15162290-15162312 TTAATCCATTTAACCCTGAGTGG + Intergenic
950819688 3:15743111-15743133 TTAATCCATTTAACCCTGAGTGG - Intronic
950843911 3:15996355-15996377 TTAATCCATTTAACCCTGAGTGG + Intergenic
951013140 3:17704180-17704202 TTAATCCATTTAACCCTGAGTGG + Intronic
951290305 3:20866416-20866438 TTAATCCATTTAACCCTGAGTGG + Intergenic
951550347 3:23870936-23870958 TTAATCCATTTAACCCTGAGTGG + Intronic
952097469 3:29970793-29970815 TTCATTAATGTGACTCTGAGTGG - Intronic
952309020 3:32170334-32170356 TTAATCCATTTAACCCTGAGTGG - Intergenic
952364795 3:32664610-32664632 TTAATCCATTTAACCCTGAGTGG - Intergenic
952892722 3:38053929-38053951 TTAATCCATTTAACCCTGAGTGG - Intronic
952896249 3:38081074-38081096 TTAATCCATTTAACCCTGAGTGG + Intronic
952934805 3:38389203-38389225 TTAATCCATTTAACCCTGAGTGG + Intronic
953037927 3:39228332-39228354 TTAATCCATTTAACCCTGAGTGG - Intergenic
953084140 3:39651145-39651167 TTAATCCATTTAACCCTGAGTGG + Intergenic
953257880 3:41306882-41306904 TTAATCCATTTAACCCTGAGTGG - Intronic
953322190 3:41982860-41982882 TTAATCCATTTAACCCTGAGTGG + Intergenic
953426483 3:42799023-42799045 TTAATCCATTTAACCCTGAGTGG - Intronic
953652517 3:44820609-44820631 TTAATCCATTTAACCCTGAGTGG + Intronic
953855342 3:46495417-46495439 TTAATCCATTTAACCCTGAGTGG - Intergenic
953922945 3:46964687-46964709 TTAATCCATTTAACCCTGAGTGG - Intronic
953959629 3:47256878-47256900 TTAATCCATTTAACCCTGAGTGG - Intronic
953966164 3:47309029-47309051 TTAATCCATTTAACCCTGAGTGG + Intronic
954059812 3:48057345-48057367 TTAATCCATTTAACTCTGAGTGG - Intronic
954060493 3:48062233-48062255 TTAATCCATTTAACCCTGAGTGG - Intronic
954081216 3:48212815-48212837 TTAATCCATTTAACCCTGAGTGG - Intergenic
954118852 3:48483347-48483369 TTAATCCATTTAACCCTGAGTGG + Intronic
954163036 3:48735173-48735195 TTAATCCATTTAACCCTGAGTGG - Intronic
954399109 3:50310859-50310881 TTAATCCATTTAACCCTGAGTGG + Intronic
954427227 3:50449801-50449823 TGAATGCCTGTGTCTCTGATGGG - Intronic
954523699 3:51250008-51250030 TTAATCCATTTAACTCTGAGTGG - Intronic
954529712 3:51308477-51308499 TTAATCCATTTAACCCTGAGTGG + Intronic
954599962 3:51859387-51859409 TTAATCCATTTAACCCTGAGTGG - Intergenic
954853870 3:53626213-53626235 TTCATCCCTCTGACCATGAGGGG - Intronic
955172787 3:56583558-56583580 TTAATCCATTTAACCCTGAGTGG + Intronic
955237276 3:57150431-57150453 AGAATCCTTGTGACTCGGAGAGG - Intronic
955297731 3:57748494-57748516 TTAATCCATTTAACCCTGAGTGG - Intergenic
955362725 3:58289493-58289515 TTAATCCATTTAACCCTGAGTGG + Intronic
955394567 3:58549329-58549351 TTAATCCATTTAACCCTGAGTGG + Intergenic
955434667 3:58889811-58889833 TTAATCCATTTAACCCTGAGTGG + Intronic
955674252 3:61434052-61434074 TTAATCCATTTAACCCTGAGTGG + Intergenic
956270890 3:67445354-67445376 TTAATCCATTTAACCCTGAGTGG - Intronic
956697293 3:71929281-71929303 TTAATCCATTTAACCCTGAGTGG - Intergenic
957035676 3:75290198-75290220 TTAATCCATTTAACCCTGAGTGG - Intergenic
957203497 3:77165297-77165319 TTAATCCATTTAACCCTGAGTGG - Intronic
957316536 3:78582740-78582762 TTAATCCATTTAACCCTGAGTGG + Intergenic
957428464 3:80070753-80070775 TTAATCCATTTAACCCTGAGTGG - Intergenic
957620392 3:82585427-82585449 TTAATCCATTTAACCCTGAGTGG - Intergenic
958560677 3:95744421-95744443 TTAATCCATTTAACCCTGAGTGG + Intergenic
958691924 3:97480491-97480513 TTAATCCATTTAACCCTGAGTGG + Intronic
958856079 3:99387376-99387398 TGAGTCCCTGAGACTTTGAGTGG - Intergenic
958943290 3:100337103-100337125 TTAATCCATTTAACCCTGAGTGG + Intronic
958957138 3:100477167-100477189 TTAATCCATTTAACCCTGAGAGG + Intergenic
959042964 3:101440307-101440329 TTAATCCATTTAACCCTGAGTGG - Intronic
959054264 3:101552215-101552237 TTAATCCATGTAACCCTGAGTGG - Intergenic
959201564 3:103254582-103254604 TTAATCCATTTAACCCTGAGTGG + Intergenic
959221837 3:103531170-103531192 TTAATCCATTTAACCCTGAGTGG + Intergenic
959414998 3:106073077-106073099 TTAATCCATTTAACCCTGAGTGG + Intergenic
959418969 3:106110791-106110813 TTAATCCATTTAACCCTGAGTGG + Intergenic
959585987 3:108025924-108025946 TTAATCCATTTAACCCTGAGTGG + Intergenic
959683993 3:109124865-109124887 TTAATCCATTTAACCCTGAGTGG - Intergenic
960526517 3:118718008-118718030 TTAATCCATTTAACCCTGAGTGG + Intergenic
960698087 3:120414726-120414748 TTAATCCATTTAACCCTGAGTGG - Intronic
960780247 3:121312719-121312741 TTAATCCATTTAACGCTGAGTGG + Intronic
960817670 3:121689386-121689408 TTAATCCATTTAACCCTGAGTGG - Intronic
960862412 3:122165639-122165661 TTAATCCATTTAACCCTGAGTGG - Intergenic
960865974 3:122201259-122201281 TTAATCCATTTAACCCTGAGTGG + Intronic
960921213 3:122748117-122748139 TTAATCCATTTAACCCTGAGTGG - Intronic
960924058 3:122779766-122779788 TTAATCCATTTAACCCTGAGTGG + Intronic
961120040 3:124366463-124366485 TTAATCCATTTAACCCTGAGTGG + Intronic
961163570 3:124749652-124749674 TTAATCCATTTAACCCTGAGTGG + Intergenic
961496172 3:127293502-127293524 TTAATCCATTTAACCCTGAGTGG + Intergenic
961704543 3:128773816-128773838 TTAATCCATTTAACCCTGAGTGG - Intronic
961729788 3:128955910-128955932 TTAATCCATTTAACCCTGAGTGG - Intronic
961784025 3:129338728-129338750 TTAATCCATTTAACCCTGAGTGG + Intergenic
961788534 3:129361958-129361980 TTAATCCATTTAACCCTGAGTGG + Intergenic
961962795 3:130869161-130869183 TTAATCCATTTAACCCTGAGTGG - Intronic
962063380 3:131952977-131952999 TTAATCCATTTAACCCTGAGTGG - Intronic
962112625 3:132470245-132470267 TTAATCCATTTAACCCTGAGTGG + Intronic
962210537 3:133473717-133473739 TTAATCCATTTAACCCTGAGTGG + Intronic
962245347 3:133785948-133785970 TTAATCCATTTAACCCTGAGTGG - Intronic
962572465 3:136724339-136724361 TTAATCCATTTAACCCTGAGTGG - Intronic
962601264 3:136992380-136992402 TTACTGCCTGTGAATCAGAGTGG + Intronic
962611284 3:137078658-137078680 TTATTCTCTGTGACTCTGGAGGG + Intergenic
962622963 3:137198121-137198143 TTAATCCATTTAACCCTGAGTGG + Intergenic
962688925 3:137873258-137873280 TTAATCCATTTAACCCTGAGTGG - Intergenic
962788068 3:138785552-138785574 TTAATCCATTTAACCCTGAGTGG - Intronic
963036026 3:141030108-141030130 TTAATCCATTTAACCCTGAGTGG + Intergenic
963244308 3:143046579-143046601 TTAATCCATTTAACCCTGAGTGG + Intronic
963248776 3:143085876-143085898 TTAATCCATTTAACCCTGAGTGG + Intergenic
963498666 3:146097534-146097556 TTAATCCATTTAACCCTGAGTGG - Intronic
963614171 3:147514007-147514029 TTAATCCCTGTCCTGCTGAGCGG - Intergenic
963770435 3:149381135-149381157 TTAATCCATTTAACCCTGAGTGG - Intergenic
963911076 3:150819661-150819683 TTAATCCATTTAACCCTGAGTGG + Intergenic
963943598 3:151120102-151120124 ATAATCCCAGCTACTCTGAGAGG + Intronic
964367087 3:155961961-155961983 TTAATCCATTTAACCCTGAGTGG + Intergenic
964766105 3:160179308-160179330 TTAATCCATTTAACCCTGAGTGG - Intergenic
965302492 3:167019410-167019432 TTAATCCATTTAACCCTGAGTGG - Intergenic
965650187 3:170924243-170924265 TTAATCCATTTAACCCTGAGTGG - Intergenic
966011822 3:175087643-175087665 TTAATCCATTTAACCCTGAGTGG - Intronic
966014977 3:175131411-175131433 TTAATCCATTTAACCCTGAGTGG + Intronic
966253337 3:177891337-177891359 TTAATCCATTTAACCCTGAGTGG + Intergenic
966360298 3:179121816-179121838 TTAATCCATTTAACCCTGAGTGG - Intergenic
966375281 3:179290556-179290578 TTAATCCATTTAACCCTGAGTGG + Intergenic
966419946 3:179727425-179727447 TTAATCCATTTAACCCTGAGTGG + Intronic
966784388 3:183609507-183609529 TTAATCCATTTAACCCTGAGTGG - Intergenic
966957515 3:184898223-184898245 TTATTCCCAGTGCCTATGAGAGG + Intronic
966966864 3:185003412-185003434 TTAATCCATTTAACCCTGAGTGG + Intronic
967178613 3:186884559-186884581 TTAATCCATTTAACCCTGAGTGG + Intergenic
967418939 3:189252150-189252172 TTAATCCATTTAACCCTGAGTGG + Intronic
967711406 3:192711682-192711704 TTAATCCATTTAACCCTGAGTGG - Intronic
967896653 3:194400909-194400931 TTAATCCATTTAACCCTGAGTGG - Intergenic
968042359 3:195599399-195599421 TTAATCCATTTAACCCTGAGTGG + Intergenic
968139573 3:196244826-196244848 TTAATCCATTTAACCCTGAGTGG - Intronic
968184114 3:196619872-196619894 TTAATCCATTTAACCCTGAGTGG + Intergenic
968201691 3:196761415-196761437 TTAATCCATTTAACCCTGAGTGG + Intronic
968221643 3:196944242-196944264 TTAATCCATTTAACCCTGAGTGG - Intergenic
968226243 3:196974063-196974085 TTAATCCATTTAACCCTGAGTGG - Intergenic
968299432 3:197601994-197602016 TTAATCCATTTAACCCTGAGTGG + Intergenic
968429737 4:550101-550123 TTAATCCATTTAACCCTGAGTGG + Intergenic
968436434 4:592676-592698 TTAATCCATTTAACCCTGAGTGG - Intergenic
968666898 4:1827547-1827569 TTAATCCATTTAACCCTGAGTGG + Intronic
969508228 4:7601929-7601951 TTAATCCATCTAACCCTGAGTGG + Intronic
970215936 4:13760728-13760750 TTAATCCATTTAACCCTGAGTGG + Intergenic
970409695 4:15792160-15792182 TTAATCCATTTAACCCTGAGTGG - Intronic
970472485 4:16392789-16392811 TTAATCCATTTAACCCTGAGTGG + Intergenic
971093518 4:23372271-23372293 TTAATCCATTTAACCCTGAGTGG - Intergenic
971415181 4:26419712-26419734 TTGATCCCTGTGAATCAGGGAGG - Intronic
971594696 4:28514456-28514478 TTAATCCATTTAACCCTGAGTGG + Intergenic
971773329 4:30927592-30927614 TTAATCCATTTAACCCTGAGTGG - Intronic
971889916 4:32507137-32507159 TTCAGCCCTGTGACTCTGCATGG - Intergenic
972270675 4:37508938-37508960 TTAATCCATTTAACCCTGAGTGG + Intronic
972288548 4:37669773-37669795 TTAATCCATTTAACCCTGAGTGG - Intronic
972412658 4:38808420-38808442 TTAATCCATTTAACCCTGAGTGG - Intronic
972551657 4:40140848-40140870 TTAATCCATTTAACCCTGAGTGG + Intronic
972552480 4:40147170-40147192 TTAATCCATTTAACCCTGAGTGG + Intronic
972654276 4:41049853-41049875 TTAATCCATTTAACCCTGAGTGG - Intronic
972938526 4:44168333-44168355 TTAATCCATTTAACCCTGAGTGG - Intergenic
972939887 4:44182523-44182545 TTAATCCATTTAACCCTGAGTGG - Intronic
973093468 4:46166865-46166887 TACATCCCTGAGAATCTGAGAGG - Intergenic
973263521 4:48187166-48187188 TTAATCCATTTAACCCTGAGTGG - Intronic
973274537 4:48293084-48293106 TTAATCCATTTAACCCTGAGTGG - Intergenic
973281141 4:48363020-48363042 TTAATCCATTTAACCCTGAGTGG + Intronic
973650520 4:52993129-52993151 TTAATCCATTTAACCCTGAGTGG - Intronic
973664201 4:53139941-53139963 TTAATCCATTTAACCCTGAGTGG - Intronic
973675031 4:53255471-53255493 TTAATCCATTTAACCCTGAGTGG + Intronic
973784847 4:54325052-54325074 TTAATCCATTTAACCCTGAGTGG + Intergenic
974021089 4:56693116-56693138 TTAATCCATTTAACCCTGAGTGG + Intergenic
974082276 4:57224915-57224937 TTAATCCATTTAACCCTGAGTGG - Intergenic
974588776 4:63918204-63918226 TTAATCCATTTAACCCTGAGTGG + Intergenic
974661875 4:64900557-64900579 TTAATCCATTTAACCCTGAGTGG - Intergenic
974870706 4:67637674-67637696 TTAATCCATTTAACCCTGAGTGG - Intronic
975633596 4:76424014-76424036 TTAATCCATTTAACCCTGAGTGG - Intergenic
975686271 4:76918599-76918621 TTAATCCATTTAACCCTGAGTGG - Intergenic
976149541 4:82078316-82078338 TTAATCCATTTAACCCTGAGTGG - Intergenic
976265353 4:83183096-83183118 TTAATCCATTTAACCCTGAGTGG - Intergenic
976265486 4:83184864-83184886 TTAATCCATTTAACCCTGAGTGG + Intergenic
976340630 4:83943087-83943109 TTAATCCATTTAACCCTGAGTGG + Intergenic
977396617 4:96479030-96479052 TCCATCCCTGTGACTCTGCAGGG - Intergenic
978014357 4:103723767-103723789 TTAATCCATTTAACCCTGAGTGG - Intergenic
978123790 4:105110976-105110998 TTAATCCATTTAACCCTGAGTGG - Intergenic
978409353 4:108410305-108410327 TTAATCCATTTAACCCTGAGTGG - Intergenic
978518769 4:109596991-109597013 TTAATCCATTTAACCCTGAGTGG + Intronic
978519861 4:109604120-109604142 TTAATCCATTTAACCCTGAGTGG - Intronic
978820113 4:112957273-112957295 TTAATCCATTTAACCCTGAGTGG + Intronic
978888792 4:113796968-113796990 TTAATCCATTTAACCCTGAGTGG - Intergenic
978947651 4:114517138-114517160 TTAATCCATTTAACCCTGAGTGG - Intergenic
979235928 4:118400099-118400121 TTAATCCATTTAACCCTGAGTGG + Intergenic
979248385 4:118535687-118535709 TTAATCCATTTAACCCTGAGTGG - Intergenic
979338301 4:119489294-119489316 TGTTTCCCTGTGAATCTGAGTGG + Intergenic
979622683 4:122812930-122812952 TTAATCCATTTAACCCTGAGTGG - Intergenic
980056270 4:128083075-128083097 TTAATCCATTTAACCCTGAGTGG + Intronic
980645880 4:135642128-135642150 TTAATCCATTTAACCCTGAGTGG - Intergenic
980883774 4:138739866-138739888 TTAATCCATTTAACCCTGAGTGG - Intergenic
980895397 4:138855001-138855023 TTAATCCATTTAACTCTGAGTGG - Intergenic
981523883 4:145693291-145693313 TTAATCCATTTAACCCTGAGTGG + Intronic
981677658 4:147358646-147358668 TTAATCCATTTAACCCTGAGTGG - Intergenic
981970905 4:150660804-150660826 TTAATCCATTTAACCCTGAGTGG - Intronic
982022015 4:151214126-151214148 TTAATCCATTTAACCCTGAGTGG + Intronic
982025967 4:151254580-151254602 TTAATCCATTTAACCCTGAGTGG + Intronic
982182725 4:152764887-152764909 TTAATCCATTTAACCCTGAGTGG + Intronic
982191895 4:152866128-152866150 TTAATCCATTTAACCCTGAGTGG + Intronic
982615538 4:157636083-157636105 TTAATCCATTTAACCCTGAGTGG + Intergenic
982709493 4:158746043-158746065 TTAATCCATTTAACCCTGAGTGG + Intergenic
982723614 4:158882732-158882754 TTAATCCATTTAACCCTGAGTGG - Intronic
982784876 4:159525008-159525030 TTAATCCATTTAACCCTGAGTGG - Intergenic
982820472 4:159938619-159938641 TTAATCCATTTAACCCTGAGTGG + Intergenic
983190219 4:164747009-164747031 TTAATCCATTTAACCCTGAGTGG + Intergenic
983217934 4:165019478-165019500 TTAATCCATTTAACCCTGAGTGG + Intergenic
983604752 4:169570914-169570936 TTAATCCATTTAACCCTGAGTGG - Intronic
983628877 4:169828957-169828979 TTAATCCATTTAACCCTGAGTGG - Intergenic
983664347 4:170165906-170165928 TTAATCCATTTAACCCTGAGTGG + Intergenic
983947425 4:173602022-173602044 TTAAACCCTGCAGCTCTGAGTGG - Intergenic
984004632 4:174294302-174294324 TTAATCCATTTAACCCTGAGTGG + Intronic
984012092 4:174383195-174383217 TTAATCCATTTAACCCTGAGTGG - Intergenic
984029567 4:174586495-174586517 TTAATCCATTTAACCCTGAGTGG + Intergenic
984038023 4:174692675-174692697 TTAATCCATTTAACCCTGAGTGG - Intronic
984484326 4:180347918-180347940 TTATTCCCTGAGACTATGATTGG + Intergenic
984728013 4:183040377-183040399 TTAATCCATTTAACCCTGAGTGG + Intergenic
985245357 4:187975041-187975063 TTAATCCATTTAACCCTGAGTGG - Intergenic
985255751 4:188068459-188068481 TTAATCCATTTAACCCTGAGTGG - Intergenic
985296838 4:188445055-188445077 TTAATCTCTGTGACTCAGCATGG + Intergenic
985296852 4:188445168-188445190 TTAATCTCTGTGACTCAGCATGG + Intergenic
985296859 4:188445225-188445247 TTAATCTCTGTGACTCAGCATGG + Intergenic
985296916 4:188445676-188445698 TTAATCTCTGTGACTCAGCATGG + Intergenic
985296946 4:188445902-188445924 TTAATCTCTGTGACTCAGCATGG + Intergenic
985297037 4:188446631-188446653 TTAATCTCTGTGACTCAGCATGG + Intergenic
985297051 4:188446745-188446767 TTAATCTCTGTGACTCAGCATGG + Intergenic
985297079 4:188446970-188446992 TTAATCTCTGTGACTCAGCATGG + Intergenic
985297093 4:188447084-188447106 TTAATCTCTGTGACTCAGCATGG + Intergenic
985297142 4:188447480-188447502 TTAATCTCTGTGACTCAGCATGG + Intergenic
985297149 4:188447537-188447559 TTAATCTCTGTGACTCAGCATGG + Intergenic
985297163 4:188447651-188447673 TTAATCTCTGTGACTCAGCATGG + Intergenic
985297212 4:188448045-188448067 TTAATCTCTGTGACTCAGCATGG + Intergenic
985297240 4:188448270-188448292 TTAATCTCTGTGACTCAGCATGG + Intergenic
985297275 4:188448551-188448573 TTAATCTCTGTGACTCAGCATGG + Intergenic
985297289 4:188448664-188448686 TTAATCTCTGTGACTCAGCATGG + Intergenic
985600607 5:827998-828020 TTAATCCATTTAACCCTGAGTGG + Intronic
985736718 5:1587039-1587061 TTAATCCATTTAACCCTGAGTGG - Intergenic
986095871 5:4553708-4553730 TCCAGCCCTGTGACTCTGGGAGG - Intergenic
986200756 5:5576152-5576174 ATAATCCCTGTGAGGTTGAGAGG + Intergenic
987267802 5:16276437-16276459 TTAATCCATTTAACCCTGAGTGG + Intergenic
987469517 5:18310461-18310483 TTAATCCATTTAACCCTGAGTGG - Intergenic
988239915 5:28596497-28596519 TTAATCCATTTAACCCTGAGTGG + Intergenic
988370100 5:30357568-30357590 TTAAATCCTTTGAATCTGAGTGG + Intergenic
988552482 5:32209371-32209393 TTAATCCATTTAACCCTGAGTGG - Intergenic
988682180 5:33494503-33494525 TTAATCTGTGTGAATCTGATTGG - Intergenic
988760045 5:34305273-34305295 TTAATCCATTTAACCCTGAGTGG + Intergenic
989048629 5:37296412-37296434 TTAATCCATTTAACCCTGAGTGG - Intronic
989061356 5:37415041-37415063 TTAATCCATTTAACCCTGAGTGG + Intronic
989068049 5:37483361-37483383 TTAATCCATTTAACCCTGAGTGG + Intronic
989241032 5:39202881-39202903 TTTGGCCCTGTGACTCTGAAGGG + Exonic
989372421 5:40723169-40723191 TTAATCCATTTAACCCTGAGTGG - Intronic
989380038 5:40801511-40801533 TTAATCCATTTAACCCTGAGTGG - Intergenic
989575174 5:42981111-42981133 TTAATCCATTTAACCCTGAGTGG - Intergenic
989587404 5:43086785-43086807 TTAATCCATTTAACCCTGAGTGG + Intronic
989633626 5:43511764-43511786 TTAATCCATTTAACCCTGAGTGG - Intronic
989635007 5:43522804-43522826 TTAATCCATTTAACTCTGAGTGG - Intergenic
989640330 5:43577881-43577903 TTAATCCATTTAACCCTGAGTGG + Intergenic
989829050 5:45891346-45891368 TTAATCCATTTAACCCTGAGTGG - Intergenic
990150902 5:52816380-52816402 TTTAAACCTGTGACTGTGAGTGG - Intronic
990297693 5:54420299-54420321 TTAATCCATTTAACCCTGAGTGG + Intergenic
990426553 5:55695526-55695548 TTAATCCATTTAACTCTGAGTGG + Intronic
990458750 5:56014179-56014201 TTAATCCATTTAACCCTGAGTGG + Intergenic
990461913 5:56038500-56038522 TTAATCCATTTAACCCTGAGTGG + Intergenic
990498729 5:56373211-56373233 TTAATCCATTTAACCCTGAGTGG - Intergenic
990870903 5:60430801-60430823 TTAATCCATTTAACCCTGAGTGG + Intronic
991073484 5:62512843-62512865 TTAATCCATTTAACCCTGAGTGG + Intronic
991127279 5:63083474-63083496 TTAATCCATTTAACCCTGAGTGG + Intergenic
991373487 5:65941052-65941074 TTAATCCATTTAACCCTGAGTGG - Intronic
991672480 5:69062522-69062544 TTAATCCATTTAACCCTGAGTGG + Intergenic
991690541 5:69220918-69220940 TTAATCCATTTAACCCTGAGTGG - Intronic
991723343 5:69514783-69514805 TTAATCCATTTAACCCTGAGTGG + Intronic
992290202 5:75271893-75271915 TTAATCCATTTAACCCTGAGTGG - Intergenic
992340618 5:75819446-75819468 TTAATCCATTTAACCCTGAGTGG - Intergenic
992374294 5:76172782-76172804 TTAATCCATTTAACCCTGAGTGG - Intronic
992391544 5:76335680-76335702 TTAATCCATTTAACCCTGAGTGG + Intronic
992415686 5:76550612-76550634 TTAATCCGTTTAACTCTGAGTGG + Intronic
992443328 5:76813404-76813426 TTAATCCATTTAACCCTGAGTGG - Intergenic
992463421 5:76984102-76984124 TTAATCCATTTAACCCTGAGTGG + Intergenic
992469427 5:77042071-77042093 TTAATCCTTTTAACCCTGAGTGG + Intronic
992544127 5:77794569-77794591 TTAATCCATTTAACCCTGAGTGG + Intronic
992574927 5:78098016-78098038 TTAATCCATTTAACCCTGAGTGG - Intronic
992600065 5:78390911-78390933 TTAATCCATTTAACCCTGAGTGG + Intronic
992801980 5:80302070-80302092 TTAATCCATTTAACCCTGAGTGG - Intergenic
992852361 5:80823955-80823977 TTAATCCATTTAACCCTGAGTGG + Intronic
992914445 5:81433343-81433365 TTAATCCATTTAACCCTGAGTGG - Intronic
992978512 5:82140959-82140981 TTAATCCATTTAACCCTGAGTGG - Intronic
993162593 5:84311818-84311840 TTAATCCATTTAACCCTGAGTGG + Intronic
993657419 5:90594743-90594765 TTAATCCATTTAACTCTGAGTGG + Intronic
995123393 5:108558634-108558656 TTAATCCATTTAACCCTGAGTGG + Intergenic
995161672 5:108992135-108992157 TTAATCCATTTAACCCTGAGTGG + Intronic
995236100 5:109832433-109832455 TTAATCCATTTAACCCTGAGTGG + Intronic
995378397 5:111504045-111504067 TTAATCTCTGTCAGTCTGAGAGG - Intronic
995516122 5:112955528-112955550 TTAATCCATTTAACTCTGAGTGG - Intergenic
995772898 5:115690980-115691002 TTAATCCATTTAACCCTGAGTGG - Intergenic
995894966 5:117002023-117002045 TTAATCCATTTAACCCTGAGTGG + Intergenic
995942110 5:117599236-117599258 TTAATCCATTTAACCCTGAGTGG + Intergenic
995994627 5:118283275-118283297 TTAATCCATTTAACCCTGAGTGG - Intergenic
996054240 5:118965672-118965694 TTAATCCATTTAACCCTGAGTGG - Intronic
996069727 5:119121540-119121562 TTAATCCATTTAACCCTGAGTGG + Intronic
996376172 5:122810137-122810159 TTAATCCATTTAACCCTGAGTGG - Intronic
996386171 5:122912972-122912994 TTAATCCATTTAACCCTGAGTGG + Intronic
996854941 5:127995287-127995309 TGAATCCCTGAGGCTCTGGGTGG - Intergenic
997321507 5:132982651-132982673 TTAATCCATTTAACCCTGAGTGG + Intergenic
997336093 5:133109510-133109532 TTAATCCATTTAACCCTGAGTGG - Intergenic
997565131 5:134881446-134881468 TTAATCCATTTAACCCTGAGTGG + Intronic
997636397 5:135409711-135409733 TTAATCCATTTAACCCTGAGCGG - Intergenic
997892547 5:137687901-137687923 TTAATCCATTTAACCCTGAGTGG - Intronic
998053833 5:139057053-139057075 TTAATCCATTTAACCCTGAGTGG - Intronic
998060186 5:139113032-139113054 TTAATCCATTTAACCCTGAGTGG - Intronic
998067690 5:139171436-139171458 TTAATCCATTTAACCCTGAGTGG - Intronic
998074546 5:139225025-139225047 TTAATCCATTTAACCCTGAGTGG - Intronic
998431538 5:142074923-142074945 TTAATCCATTTAACCCTGAGTGG + Intergenic
999455546 5:151713660-151713682 TTAATCCATTTAACCCTGAGTGG + Intergenic
999532496 5:152479501-152479523 TTAATCCATTTAACCCTGAGTGG + Intergenic
999580920 5:153037019-153037041 TTAATCCATTTAACCCTGAGTGG - Intergenic
999603774 5:153295833-153295855 TTAATCCATTTAACCCTGAGTGG + Intergenic
999987158 5:157014819-157014841 TTAATCCATTTAACCCTGAGTGG - Intergenic
1000033152 5:157420370-157420392 TTAATCCATTTAACCCTGAGTGG - Intronic
1000103253 5:158036626-158036648 TTAATCCATTTAACCCTGAGTGG + Intergenic
1000159556 5:158583717-158583739 TTAATCCATTTAACCCTGAGTGG - Intergenic
1000815769 5:165919740-165919762 TTAATCCATTTAACCCTGAGTGG - Intergenic
1000985937 5:167860778-167860800 TTAATCCATTTAACCCTGAGTGG - Intronic
1001077673 5:168642913-168642935 TTAATCCATTTAACCCTGAGTGG + Intergenic
1001087993 5:168715428-168715450 CCAATCACTGTGACTCTGATTGG - Intronic
1001222848 5:169917453-169917475 TTAATTACTGTGACTATCAGTGG + Intronic
1001366702 5:171148125-171148147 TTAATCCATTTAACCCTGAGTGG - Intronic
1001393863 5:171403265-171403287 TTAATCCATTTAACCCTGAGTGG + Intronic
1001638316 5:173228359-173228381 TTATTCCCTTTGAGTCTGAGAGG - Intergenic
1001910582 5:175514096-175514118 TTTATCTGTGTGACTCTGGGTGG + Intronic
1002007899 5:176251840-176251862 TTAATCCATTTAACCCTGAGTGG + Intronic
1002014272 5:176306648-176306670 TTAATCCTTTTAACCCTGAGTGG - Intronic
1002031733 5:176434548-176434570 TTAATCCATTTAACCCTGAGTGG - Intergenic
1002116312 5:176962883-176962905 TTAATCCATTTAACCCTGAGTGG - Intronic
1002341263 5:178518155-178518177 TTAATCCATTTAACCCTGAGTGG + Intronic
1002501441 5:179650081-179650103 TTAATCCATTTAACCCTGAGTGG + Intergenic
1002529336 5:179834672-179834694 TTAATCCATTTAACCCTGAGTGG + Intronic
1002626077 5:180530826-180530848 TTAATCCATTTAACCCTGAGTGG + Intronic
1002722061 5:181267640-181267662 TTAATCCATTTAACCCTGAGTGG + Intergenic
1002964686 6:1951945-1951967 GAAACCCCTGTGACACTGAGTGG - Intronic
1003319187 6:5037268-5037290 TTAATCCATTTAACCCTGAGTGG + Intergenic
1004414702 6:15415073-15415095 TTAATCCATTTAACCCTGAGTGG + Intronic
1004448606 6:15725816-15725838 TTAATCCATTTAACCCTGAGTGG + Intergenic
1004664008 6:17734928-17734950 TTAATCCATTTAACCCTGAGTGG + Intergenic
1004874858 6:19940887-19940909 TTAATCCATTTAACCCTGAGTGG - Intergenic
1005159132 6:22837615-22837637 TTAATCCATTTAACCCTGAGTGG - Intergenic
1005227491 6:23659495-23659517 TTAGTACATGTGACTCTCAGAGG - Intergenic
1005294754 6:24414409-24414431 TTAATCCATTTAACCCTGAGTGG + Intronic
1005414389 6:25585807-25585829 TTAATCCATTTAACCCTGAGTGG + Intronic
1005611452 6:27529630-27529652 TTAATCCATTTAACCCTGAGTGG + Intergenic
1005865562 6:29933476-29933498 TTAATCCATTTAACCCTGAGTGG - Intergenic
1005901635 6:30221744-30221766 TTAATCCATTTAACCCTGAGTGG + Intergenic
1005929945 6:30475721-30475743 TTAATCCATTTAACCCTGAGTGG - Intergenic
1005933087 6:30498419-30498441 TTAATCCATTTAACCCTGAGTGG + Intergenic
1006004657 6:30992827-30992849 TTAATCCATTTAACCCTGAGTGG + Intergenic
1006014063 6:31066864-31066886 TTAATCCATTTAACCCTGAGTGG + Intergenic
1006064441 6:31454006-31454028 TTAATCCATTTAACCCTGAGTGG + Intergenic
1006128161 6:31853542-31853564 TTAATCCATTTAACCCTGAGTGG + Intergenic
1006231774 6:32594456-32594478 TTAATCCATTTAACCCTGAGTGG + Intergenic
1006351769 6:33525884-33525906 TTAATCCATTTAACCCTGAGTGG - Intergenic
1006403672 6:33832199-33832221 TTAATCCATTTAACCCTGAGTGG + Intergenic
1006492777 6:34398862-34398884 TTAATCCATTTAACCCTGAGTGG - Intronic
1006546856 6:34787275-34787297 TTAATCCATTTAACCCTGAGTGG - Intergenic
1006624136 6:35385368-35385390 TTAATCCGTTTAACCCTGAGTGG - Intronic
1006826967 6:36942208-36942230 TTAATCCATTTAACCCTGAGTGG - Intergenic
1007063314 6:38963955-38963977 TTAATCCATTTAACCCTGAGTGG + Intronic
1007403312 6:41616918-41616940 TTAATCCATTTAACCCTGAGTGG - Intergenic
1007523180 6:42467146-42467168 TTAATCCATTTAACCCTGAGTGG - Intergenic
1007673998 6:43580168-43580190 TTAATCCATTTAACCCTGAGTGG + Intronic
1007994422 6:46291161-46291183 TTAATCACTGTGTTTCTAAGAGG + Intronic
1008111969 6:47505287-47505309 TTAATCCATTTAACCCTGAGTGG + Intronic
1008128773 6:47697090-47697112 TAAATCCCTGAGACTTTAAGTGG + Intronic
1008184228 6:48370923-48370945 TTAATCCATTTAACCCTGAGTGG + Intergenic
1008377563 6:50809704-50809726 TTAATCCATTTAACCCTGAGTGG + Intergenic
1008480806 6:51982545-51982567 TTAATCCATTTAACCCTGAGTGG - Intronic
1008553449 6:52655248-52655270 TTAATCCATTTAACCCTGAGTGG + Intergenic
1008624507 6:53304685-53304707 TTAATCCATTTAACCCTGAGTGG + Intronic
1008841417 6:55909575-55909597 TTAATCCATTTAACCCTGAGTGG + Intergenic
1008909768 6:56720613-56720635 TTAATCCATTTAACCCTGAGTGG + Intronic
1008919346 6:56825234-56825256 TTAATCCATTTAACCCTGAGTGG - Intronic
1008926108 6:56893857-56893879 TTAATCCATCTAACCCTGAGTGG + Intronic
1009035791 6:58115994-58116016 ATAATCCCAGTAACTCTGGGAGG + Intergenic
1009049190 6:58258314-58258336 TTAATCCATTTAACCCTGAGTGG - Intergenic
1009211612 6:60869595-60869617 ATAATCCCAGTAACTCTGGGAGG + Intergenic
1009622561 6:66096404-66096426 TTAATCCATTTAACCCTGAGTGG + Intergenic
1009628977 6:66170137-66170159 TTAATCCATTTAACCCTGAGTGG - Intergenic
1010192022 6:73205371-73205393 TTAATCCATTTAACCCTGAGTGG + Intergenic
1010239540 6:73602174-73602196 TTAATCCATTTAACCCTGAGTGG - Intronic
1010245713 6:73660101-73660123 TTAATCCATTTAACCCTGAGTGG + Intergenic
1010270782 6:73914558-73914580 TTAATCCATTTAACCCTGAGTGG + Intergenic
1010271968 6:73925558-73925580 TTAATCCATTTAACCCTGAGTGG + Intergenic
1010300535 6:74254774-74254796 TTAATCCATTTAACCCTGAGTGG + Intergenic
1010319478 6:74489268-74489290 TTAATCCATTTAACCCTGAGTGG - Intergenic
1010400348 6:75441241-75441263 TTAATCCATTTAACCCTGAGTGG + Intronic
1010513404 6:76745233-76745255 TTAATCCATTTAACCCTGAGTGG - Intergenic
1011148368 6:84244019-84244041 TTAATCCATTTAACCCTGAGTGG + Intergenic
1011291484 6:85781518-85781540 TTAATCCATTTAACCCTGAGTGG - Intergenic
1011297456 6:85839419-85839441 TTAATCCATTTAACCCTGAGTGG - Intergenic
1011404921 6:87009320-87009342 TTAATCCGTTTAACCCTGAGTGG + Intronic
1011426631 6:87238940-87238962 TTAATCCATTTAACCCTGAGTGG + Intronic
1011474088 6:87735602-87735624 TTAATCCATTTAACCCTGAGTGG + Intergenic
1011475906 6:87750630-87750652 TTAATCCATTTAACCCTGAGTGG + Intergenic
1011588558 6:88948847-88948869 TTAATCCATTTAACCCTGAGTGG - Intronic
1011629602 6:89311251-89311273 TTACTCCCTGTGAGTCAGAGGGG - Intronic
1011967135 6:93173531-93173553 TTAATCCATTTAACTCTGAGTGG - Intergenic
1012428807 6:99142602-99142624 TTAATCCATTTAACCCTGAGTGG - Intergenic
1012479237 6:99649789-99649811 TTAATCCATTTAACCCTGAGTGG + Intergenic
1012899482 6:104990821-104990843 TTAATCCATTTAACCCTGAGTGG + Intronic
1013204922 6:107935526-107935548 TTAATCCATTTAACCCTGAGTGG - Intronic
1013207004 6:107954202-107954224 TTAATCCATTTAACCCTGAGTGG - Intronic
1013244121 6:108270670-108270692 TTAATCCATTTAACCCTGAGTGG - Intergenic
1013326321 6:109047830-109047852 TTAATCCATTTAACCCTGAGTGG - Intronic
1013530651 6:111016942-111016964 TTAATCCATTTAACCCTGAGTGG + Intronic
1013638140 6:112048091-112048113 TTAATCCATTTAACCCTGAGTGG - Intergenic
1013679485 6:112508596-112508618 TTAATCCATTTAACCCTGAGTGG + Intergenic
1013681171 6:112527920-112527942 TTAATCCATTTAACCCTGAGTGG + Intergenic
1013955645 6:115836884-115836906 TTAATCCATTTAACCCTGAGTGG - Intergenic
1014123457 6:117751372-117751394 TTAATCCATTTAACCCTGAGTGG - Intergenic
1014556583 6:122848045-122848067 TTAATCCATTTAACCCTGAGTGG + Intergenic
1014763722 6:125387946-125387968 TTAATCCATTTAACCCTGAGTGG + Intergenic
1014800453 6:125771380-125771402 TTAATCCATTTAACCCTGAGTGG - Intergenic
1015252779 6:131144020-131144042 TTAATCCATTTAACCCTGAGTGG + Intronic
1015477067 6:133665919-133665941 TTAATCCATTTAACCCTGAGTGG - Intergenic
1016476284 6:144432944-144432966 TTAATCCATTTAACCCTGAGTGG + Intronic
1016973314 6:149785666-149785688 TTAATCCATTTAACCCTGAGTGG + Intronic
1017160501 6:151361276-151361298 CTTATCCCTGTGACCCTCAGGGG + Intergenic
1017170583 6:151450937-151450959 TTAATCCATTCAACTCTGAGTGG - Intronic
1017384807 6:153871062-153871084 TTAATCTCTTTGACGCTCAGAGG - Intergenic
1017465328 6:154687988-154688010 TTAATCCATTTAACTCTGAGTGG - Intergenic
1017493642 6:154965858-154965880 TTAATCCATTTAACCCTGAGTGG + Intronic
1017660831 6:156670901-156670923 TTAATCCATTTAACCCTGAGTGG - Intergenic
1017830931 6:158127732-158127754 TTAATCCATTTAACCCTGAGTGG - Intronic
1017843146 6:158238686-158238708 TTAATCCATTTAACCCTGAGTGG + Intronic
1017851242 6:158308260-158308282 TTAATCCATTTAACCCTGAGTGG + Intronic
1018235756 6:161721985-161722007 TCCCTCCCTGTGAGTCTGAGTGG - Intronic
1018528039 6:164735809-164735831 TTAATCCATTTAACCCTGAGTGG + Intergenic
1019191575 6:170254112-170254134 TGGATCCCTGTGGCTCTCAGTGG - Intergenic
1019439823 7:1039908-1039930 TTAATCCATTTAACCCTGAGTGG - Intronic
1019458596 7:1145739-1145761 TTAATCCATTTAACCCTGAGTGG + Intergenic
1019651675 7:2162323-2162345 TTAATCCATTTAACCCTGAGTGG - Intronic
1019669423 7:2269249-2269271 TTAATCCATTTAACCCTGAGTGG - Intronic
1019674684 7:2303690-2303712 TTAATCCATTTAACCCTGAGTGG - Intronic
1019687571 7:2390184-2390206 TTAATCCATTTAACCCTGAGTGG + Intergenic
1019714766 7:2533751-2533773 TTAATCCATTTAACCCTGAGTGG + Intergenic
1019976171 7:4583205-4583227 TTAATCCATTCAACTCTGAGTGG + Intergenic
1019977105 7:4591709-4591731 TTAATCCATTTAACCCTGAGTGG + Intergenic
1019978041 7:4600212-4600234 TTAATCCATTTAACCCTGAGTGG + Intergenic
1019981495 7:4624636-4624658 TTAATCCATTTAACTCTGAGTGG - Intergenic
1020284495 7:6670491-6670513 TTAATCCATTTAACCCTGAGTGG + Intergenic
1020325776 7:6974617-6974639 TTAATCCATTTAACCCTGAGTGG + Intergenic
1020498955 7:8891021-8891043 TTAATCCATTTAACCCTGAGTGG - Intergenic
1020616157 7:10464982-10465004 TTAATCCATTTAACCCTGAGTGG + Intergenic
1020831917 7:13103407-13103429 TTAATCCATTTAACCCTGAGTGG - Intergenic
1021010238 7:15453856-15453878 ACAATCCCTGAGACTCAGAGTGG - Intronic
1021101891 7:16593840-16593862 TTAATCTCTGAGACTCTATGAGG - Intergenic
1021120086 7:16789311-16789333 TTAATCCATTTAACCCTGAGTGG + Intergenic
1021439727 7:20664139-20664161 ATGATCCTTCTGACTCTGAGAGG - Intronic
1021440552 7:20669463-20669485 TTAATCCATTTAACCCTGAGTGG - Intronic
1021586085 7:22210121-22210143 CTAATGCCTATGACTCTCAGAGG + Intronic
1021647556 7:22801583-22801605 TTAATCCATTTAACCCTGAGTGG - Intergenic
1021672113 7:23045553-23045575 TTAATCCATTTAACCCTGAGTGG + Intergenic
1021736010 7:23638451-23638473 TTAATCCATTTAACCCTGAGTGG - Intronic
1021872835 7:25019951-25019973 TTAATCCATTTAACCCTGAGTGG - Intergenic
1022005618 7:26262755-26262777 TTAATCCATTTAACCCTGAGTGG - Intergenic
1022083634 7:27045872-27045894 TTAATCCATTTAACCCTGAGTGG - Intergenic
1022274179 7:28839261-28839283 TTAATCCATTTAACCCTGAGTGG - Intergenic
1022393163 7:29961328-29961350 TTAATCCATTTAACCCTGAGTGG + Intronic
1022663348 7:32387134-32387156 TTAATCCATTTAACCCTGAGTGG + Intergenic
1022700486 7:32754515-32754537 TTAATCCATTTAACCCTGAGTGG - Intergenic
1023044320 7:36197649-36197671 TTAATCCATTTAACCCTGAGTGG - Intronic
1023573114 7:41592980-41593002 TTAAATCCTATGACTTTGAGTGG + Intergenic
1023971192 7:44992313-44992335 TTAATCCATTTAACCCTGAGTGG + Intergenic
1024309992 7:47960105-47960127 TTAATCCATTTAACCCTGAGTGG - Intronic
1024539068 7:50460785-50460807 TTAATCCATTTAACCCTGAGTGG - Intronic
1024625990 7:51208797-51208819 TTAATCCATTTAACCCTGAGTGG - Intronic
1024931058 7:54667282-54667304 TTAATCCATTTAACCCTGAGTGG + Intergenic
1024988827 7:55219335-55219357 TTAATCCATTTAACCCTGAGTGG + Intronic
1025011326 7:55401800-55401822 TTAATCCATTTAACCCTGAGTGG + Intronic
1025103530 7:56152266-56152288 TTAATCCATTTAACCCTGAGTGG - Intergenic
1025161387 7:56664154-56664176 TTTATCACTGTGCCTGTGAGTGG - Intergenic
1025572867 7:62599363-62599385 TTAATCCATTTAACCCTGAGTGG + Intergenic
1025707025 7:63874885-63874907 TTAATCCATTTAACCCTGAGTGG - Intergenic
1025749811 7:64283878-64283900 TTTATCACTGTGCCTGTGAGAGG + Intergenic
1025778374 7:64577855-64577877 TTAATCCATTTAACCCTGAGTGG - Intergenic
1025793816 7:64718606-64718628 TTAATCCATTTAACCCTGAGTGG - Intergenic
1025795738 7:64738046-64738068 TTAATCCATTTAACCCTGAGTGG + Intergenic
1025803382 7:64808843-64808865 TTAATCCATTTAACCCTGAGTGG + Intronic
1025808636 7:64857384-64857406 TTAATCCATTTAACCCTGAGTGG - Intergenic
1025853549 7:65259975-65259997 TTAATCCATTTAACCCTGAGTGG - Intergenic
1025979043 7:66392991-66393013 TTAATCCATTTAACCCTGAGTGG + Intronic
1026008132 7:66615225-66615247 TTAATCCATTTAACCCTGAGTGG - Intergenic
1026186272 7:68083979-68084001 TTAATCCATTTAACCCTGAGTGG - Intergenic
1026333245 7:69371698-69371720 TTAATCCAGGAGGCTCTGAGAGG + Intergenic
1026783102 7:73283547-73283569 TTAATCCATTTAACCCTGAGTGG + Intergenic
1026861977 7:73796848-73796870 TTAATCCATTCAACTCTGAGTGG + Intergenic
1027087610 7:75275465-75275487 TTAATCCATTTAACCCTGAGTGG - Intergenic
1027371472 7:77510314-77510336 TTAATCCATTTAACCCTGAGTGG - Intergenic
1027373650 7:77533163-77533185 TTCATCCATTTAACTCTGAGTGG + Intergenic
1028227146 7:88265739-88265761 TTAATCCATTTAACCCTGAGTGG + Intergenic
1028430666 7:90744269-90744291 TTAATCCATTTAACCCTGAGTGG + Intronic
1028595579 7:92544668-92544690 TTAATCCATTTAACCCTGAGTGG + Intergenic
1028685360 7:93585491-93585513 TTAATCCATTTAACCCTGAGTGG + Intergenic
1029279740 7:99427840-99427862 TTAATCCATTTAACCCTGAGTGG - Intronic
1029334287 7:99887568-99887590 TTAATCCATTTAACCCTGAGTGG + Intronic
1029429627 7:100522456-100522478 TTAATCCATTTAACCCTGAGTGG + Intergenic
1029468387 7:100740559-100740581 TTAATCCATTTAACCCTGAGTGG + Intronic
1029525869 7:101093071-101093093 TTAATCCATTTAACCCTGAGTGG - Intergenic
1029568865 7:101358256-101358278 TTAATCCATTTAACCCTGAGTGG + Intergenic
1029963101 7:104709491-104709513 TTAATCCATTTAACCCTGAGTGG + Intronic
1030036100 7:105410274-105410296 TTAATCCATTTAACCCTGAGTGG + Intergenic
1030288432 7:107848780-107848802 TTAATCCATTTAACCCTGAGTGG - Intergenic
1030329497 7:108256359-108256381 TTAATCCATTTAACCCTGAGTGG - Intronic
1030368493 7:108672125-108672147 TTAATCCATTTAACTCTGAGTGG - Intergenic
1030603040 7:111610890-111610912 TTAATCCATTTAACCCTGAGTGG - Intergenic
1030652301 7:112128650-112128672 TTAATCCATTTAACCCTGAGTGG - Intronic
1030692863 7:112552342-112552364 TTAATCCATTTAACCCTGAGTGG - Intergenic
1030706234 7:112696910-112696932 TTAATCCATTTAACCCTGAGTGG + Intergenic
1030725837 7:112923213-112923235 TTAATCCATTTAACCCTGAGTGG - Intronic
1032042641 7:128576269-128576291 TTAATCCATTTAACCCTGAGTGG + Intergenic
1032056829 7:128690142-128690164 TTAATCCATTTAACCCTGAGTGG - Intergenic
1032156737 7:129475823-129475845 TTAATCCATTTAACCCTGAGTGG + Intronic
1032179447 7:129663015-129663037 TTAATCCATTTAACCCTGAGTGG + Intronic
1032589465 7:133178051-133178073 TTAATCCATTTAACCCTGAGTGG - Intergenic
1033114359 7:138612131-138612153 TTAATCCATTTAACCCTGAGTGG - Intronic
1033173193 7:139101743-139101765 TTAATCCATTTAACCCTGAGTGG - Intronic
1033212091 7:139467571-139467593 TTAATCCATTTAACCCTGAGTGG - Intronic
1033219591 7:139519634-139519656 TTAATCCATTTAACCCTGAGTGG + Intergenic
1033294242 7:140115529-140115551 TTAATCCATTTAACCCTGAGTGG - Intronic
1033324164 7:140363429-140363451 TTAATCCATTTAACCCTGAGTGG - Intronic
1033349910 7:140553756-140553778 TTAATCCATTTAACCCTGAGTGG + Intronic
1033376003 7:140762866-140762888 TTAATCCATTTAACCCTGAGTGG + Intronic
1034034026 7:147801582-147801604 TTAATCCATTTAACCCTGAGTGG + Intronic
1034234444 7:149555583-149555605 TTAATCCATTTAACCCTGAGTGG - Intergenic
1034322732 7:150199341-150199363 TTAATCCATTTAACCCTGAGTGG - Intergenic
1034361753 7:150505970-150505992 TTAATCCATTTAACCCTGAGTGG + Intergenic
1034723175 7:153314302-153314324 TTAATCCATTTAACCCTGAGTGG + Intergenic
1034915471 7:155035033-155035055 TTAATCCATTTAACCCTGAGTGG - Intergenic
1034922620 7:155096552-155096574 TTAATCCATTTAACCCTGAGTGG + Intergenic
1034961281 7:155366340-155366362 TTAATCCATTTAACCCTGAGTGG + Intronic
1035256185 7:157629307-157629329 CTAATTTCTGTGACTCTGAATGG - Intronic
1035412700 7:158657888-158657910 TTAATCCATTTAACTCTGAGTGG - Intronic
1035507625 8:149105-149127 TTAATCCATTTAACCCTGAGTGG + Intergenic
1035611936 8:972878-972900 TTAATCCATTTAACCCTGAGTGG + Intergenic
1035789435 8:2290173-2290195 TGAATCCTTGGGATTCTGAGAGG - Intergenic
1035803370 8:2431532-2431554 TGAATCCTTGGGATTCTGAGAGG + Intergenic
1035982000 8:4382789-4382811 TTAATGCATCTGACACTGAGGGG - Intronic
1036096109 8:5725950-5725972 TTAATCCATTTAACCCTGAGTGG - Intergenic
1036482875 8:9153663-9153685 TTAATCCATTTAACCCTGAGTGG + Intronic
1036506840 8:9364633-9364655 TTAATCCATTTAACCCTGAGTGG + Intergenic
1036536422 8:9656879-9656901 TTAATCCATTTAACCCTGAGTGG + Intronic
1036737385 8:11330652-11330674 TTAATCCATTTAACCCTGAGTGG - Intergenic
1036908833 8:12734486-12734508 CTAAAGCCTGTGATTCTGAGAGG - Intronic
1037134492 8:15445576-15445598 TTAATCCATTTAACCCTGAGTGG + Intronic
1038595537 8:28882190-28882212 TTAATCCATTTAACCCTGAGTGG - Intronic
1038744562 8:30246184-30246206 TTAATCCATTTAACCCTGAGTGG + Intergenic
1039072064 8:33657794-33657816 TTAATCCATTTAACCCTGAGTGG + Intergenic
1039153000 8:34528247-34528269 TTAATCCATTTAACCCTGAGTGG + Intergenic
1039488352 8:37928432-37928454 TTAATCCATTTAACCCTGAGTGG - Intergenic
1039515987 8:38134057-38134079 TTAATCCATTTAACCCTGAGTGG - Intronic
1039753082 8:40496084-40496106 TTAATCCATTTAACCCTGAGTGG + Intergenic
1039807566 8:41014186-41014208 TTAATCCATTTAACCCTGAGTGG + Intergenic
1039845433 8:41322242-41322264 TTAGGACCTGTGACTCAGAGAGG - Intergenic
1039881036 8:41625969-41625991 TTAATCCATTTAACCCTGAGTGG + Intergenic
1040043278 8:42938975-42938997 TTAATCCATTTAACCCTGAGTGG + Intronic
1040052701 8:43032649-43032671 TTAATCCATTTAACCCTGAGTGG + Intronic
1040069474 8:43178870-43178892 TTAATCCATTTAACCCTGAGTGG + Intronic
1040093087 8:43418881-43418903 TTAATCCATTTAACCCTGAGTGG + Intergenic
1040121105 8:43687132-43687154 TTAATCCATTTAACCCTGAGTGG + Intergenic
1040819082 8:51535453-51535475 TTAATCCATTTAACCCTGAGTGG - Intronic
1040834712 8:51719376-51719398 TTAATCCATTTAACCCTGAGTGG - Intronic
1041071042 8:54126176-54126198 TTAATCCATTTAACCCTGAGTGG - Intergenic
1041270195 8:56103906-56103928 TTAATCCATTTAACCCTGAGTGG + Intergenic
1041358345 8:57022917-57022939 TTAATCCATTTAACCCTGAGTGG - Intergenic
1041362817 8:57071048-57071070 TTAATCCATTTAACCCTGAGTGG + Intergenic
1041796236 8:61752131-61752153 TTAATCCATTTAACCCTGAGTGG + Intergenic
1042049381 8:64686864-64686886 TTAATCCATTTAACCCTGAGTGG - Intronic
1042134124 8:65617355-65617377 TTAATCCATTTAACCCTGAGTGG - Intronic
1042196304 8:66233173-66233195 TTAATCCATTTAACCCTGAGTGG - Intergenic
1042290587 8:67166983-67167005 TTAATCCATTTAACCCTGAGTGG + Intronic
1042303924 8:67311973-67311995 TTAATCCATTTAACCCTGAGTGG - Intronic
1042319606 8:67461320-67461342 TTAATCCATTTAACCCTGAGTGG + Intronic
1042475939 8:69246596-69246618 TTAATCCATTTAACTCTGAGTGG - Intergenic
1043958403 8:86389415-86389437 TTAATCCATTTAACCCTGAGTGG + Intronic
1043961451 8:86423483-86423505 TTAATCCATTTAACCCTGAGTGG + Intronic
1043985745 8:86693704-86693726 TTAATCCATTTAACCCTGAGTGG + Intronic
1044364960 8:91334006-91334028 TTCATCCCTGACACTCTGAGGGG - Intronic
1044507794 8:93039946-93039968 TTAATCCATTTAACCCTGAGTGG - Intergenic
1044597114 8:93970300-93970322 TTAATCCATTTAACCCTGAGTGG + Intergenic
1044661107 8:94592091-94592113 TTAATCCATTTAACCCTGAGTGG - Intergenic
1044998895 8:97863059-97863081 GTAATCCCAGTTACTCAGAGAGG - Intergenic
1045120084 8:99027971-99027993 TTAATCCATTTAACCCTGAGTGG + Intronic
1045195759 8:99927762-99927784 TTAATCCATTTAACCCTGAGTGG - Intergenic
1045235892 8:100351900-100351922 TTAATCCATTTAACCCTGAGTGG - Intronic
1045524333 8:102929058-102929080 TTAATCCATTTAACCCTGAGTGG - Intronic
1046377519 8:113405125-113405147 TTAATCCCAGTAACTTTGAAAGG + Intronic
1046636974 8:116680562-116680584 TTAATCCATTTAACCCTGAGTGG - Intronic
1047099023 8:121656762-121656784 TTAATCCATTTAACCCTGAGTGG + Intergenic
1047687709 8:127317616-127317638 TTAATCCATTTAACCCTGAGTGG - Intergenic
1047720028 8:127630572-127630594 TTAATCCATTTAACCCTGAGCGG - Intergenic
1047847602 8:128825240-128825262 TTAATCCATTTAACCCTGAGTGG + Intergenic
1048368777 8:133758801-133758823 TTAATCCATTTAACCCTGAGTGG - Intergenic
1048760996 8:137795112-137795134 TTAGTCCCTGTATCTCTAAGGGG + Intergenic
1048775726 8:137943903-137943925 TGAATCCCTGTTTCTCTGAGTGG + Intergenic
1049177230 8:141201808-141201830 TTAATCCATTTAACCCTGAGTGG + Intergenic
1049481520 8:142826634-142826656 TTAATCCATTTAACCCTGAGTGG + Intergenic
1049739540 8:144231067-144231089 TTAATCCATTTAACCCTGAGTGG + Intronic
1049892417 9:83158-83180 TTAATCCATTTAACCCTGAGTGG + Intergenic
1049934241 9:485263-485285 TGTATCACTCTGACTCTGAGGGG - Intronic
1050535005 9:6623351-6623373 TTAATCCATTTAACCCTGAGTGG - Intronic
1050557008 9:6798498-6798520 TTAATCCATTTAACCCTGAGTGG + Intronic
1050558415 9:6808429-6808451 TTAATCCATTTAACCCTGAGTGG - Intronic
1050571798 9:6948743-6948765 TTAATCCATTTAACCCTGAGTGG + Intronic
1050862365 9:10449976-10449998 TTAATCCATTTAACCCTGAGTGG - Intronic
1051258246 9:15234765-15234787 TTAATCCATTTAACCCTGAGTGG - Intronic
1051277141 9:15407461-15407483 TTAATCCGTTTAACCCTGAGTGG - Intergenic
1051430483 9:16977001-16977023 TTAATCCATTTAACCCTGAGTGG + Intergenic
1051661719 9:19433413-19433435 TTAATCCATTTAACTCTGAGTGG + Intronic
1052236034 9:26214452-26214474 TTAATCCATTTAACCCTGAGTGG + Intergenic
1052338613 9:27343210-27343232 TTAATCCATTTAACCCTGAGTGG - Intronic
1052492510 9:29188277-29188299 TTAATCCATTTAACCCTGAGTGG + Intergenic
1052881176 9:33601560-33601582 TTAATCCATTTAACCCTGAGTGG - Intergenic
1052888042 9:33668092-33668114 TTAATCCATTTAACCCTGAGTGG - Intergenic
1052942209 9:34138475-34138497 TTAATCCATTTAACCCTGAGTGG - Intergenic
1053255621 9:36614696-36614718 TTAATCCATTTAACCCTGAGTGG + Intronic
1053407693 9:37891591-37891613 TTAATCCATTTAACCCTGAGTGG - Intronic
1053457681 9:38243325-38243347 TTAATCCATTTAACCCTGAGTGG - Intergenic
1053468319 9:38325699-38325721 TTAATCCATTTAACCCTGAGTGG - Intergenic
1053634576 9:39983604-39983626 TTAATCCATTTAACCCTGAGTGG - Intergenic
1054209311 9:62267093-62267115 TTAATCCATTTAACCCTGAGTGG + Intergenic
1054359864 9:64101655-64101677 TTAATCCATTTAACCCTGAGTGG - Intergenic
1055133728 9:72805803-72805825 TTAATCCATTTAACCCTGAGTGG + Intronic
1055136873 9:72839850-72839872 TTAATCCATTTAACCCTGAGTGG + Intergenic
1055242329 9:74198376-74198398 TTAATCCATTTAACCCTGAGTGG - Intergenic
1055298078 9:74853593-74853615 TTAATCCATTTAACCCTGAGTGG - Intronic
1055413997 9:76063588-76063610 TTAATCCATTTAACCCTGAGTGG + Intronic
1055586759 9:77762834-77762856 TTAATCCATTTAACCCTGAGTGG - Intronic
1055948780 9:81711645-81711667 TTAATCCATTTAACCCTGAGTGG - Intergenic
1056097949 9:83273366-83273388 TTAATCCATTTAACCCTGAGTGG - Intronic
1056145941 9:83729115-83729137 TTAATCCATTTAACCCTGAGTGG - Intergenic
1056152933 9:83805202-83805224 TTAATCCATTTAACCCTGAGTGG - Intronic
1056336501 9:85574206-85574228 TTAATCCATTTAACCCTGAGTGG - Intronic
1056563940 9:87757814-87757836 TTAATCCATTTAACCCTGAGTGG + Intergenic
1056671004 9:88626762-88626784 TTAATCCATTTAACCCTGAGTGG - Intergenic
1056706781 9:88958970-88958992 TTAATCCATTTAACCCTGAGTGG + Intergenic
1057629267 9:96707096-96707118 TTAATCCATTTAACCCTGAGTGG + Intergenic
1057630380 9:96715294-96715316 TTAATCCATTTAACCCTGAGTGG + Intergenic
1058019237 9:100069026-100069048 TTAATCCATTTAACCCTGAGTGG - Intronic
1058390349 9:104489477-104489499 TTAATCCATTTAACCCTGAGTGG + Intergenic
1058659415 9:107256313-107256335 TTAATCCATTTAACCCTGAGTGG + Intergenic
1058673513 9:107380653-107380675 TTATCCCCTGTGATCCTGAGGGG - Intergenic
1058723253 9:107778014-107778036 TTAATCCATTTAACCCTGAGTGG - Intergenic
1058897296 9:109411409-109411431 TTAATCCCTGTGACTCTGAGGGG - Intronic
1058972609 9:110097211-110097233 TTAATCCATTTAACCCTGAGTGG + Intronic
1059118028 9:111617107-111617129 TTAATCCATTTAACCCTGAGTGG + Intergenic
1059121416 9:111642345-111642367 TTAATCCATTTAACTCTGAGTGG - Intronic
1059211534 9:112515620-112515642 TTAATCCATTTAACCCTGAGTGG - Intronic
1059324434 9:113495634-113495656 TTGATCCTTCTGACTCTGTGAGG - Intronic
1059879743 9:118677601-118677623 TTAATCCATTTAACCCTGAGTGG + Intergenic
1060334847 9:122711675-122711697 TTAATCCATTTAACCCTGAGTGG - Intergenic
1060350357 9:122853117-122853139 TTAAGCCATTTAACTCTGAGTGG - Intronic
1060352197 9:122868477-122868499 TTAATCCATTTAACCCTGAGTGG - Intronic
1060369513 9:123056739-123056761 TTAATCCATTTAACCCTGAGTGG + Intronic
1060583752 9:124772935-124772957 CTAAACCCTGTGACTAAGAGAGG + Intergenic
1060625682 9:125109093-125109115 TTAATCCATTTAACCCTGAGTGG - Intronic
1060651141 9:125328459-125328481 TTAATCCATTTAACCCTGAGTGG + Intronic
1060669628 9:125458475-125458497 TTAATCCATTTAACCCTGAGTGG + Intronic
1060687574 9:125624975-125624997 TTAATCCATTTAACTCTGAGTGG - Intronic
1060703421 9:125779518-125779540 TTAATCCATTTAACCCTGAGTGG + Intronic
1061635997 9:131908612-131908634 TTAATCCATTTAACCCTGAGTGG - Intronic
1061982535 9:134115041-134115063 TTAATCCATTTAACCCTGAGTGG + Intergenic
1062579393 9:137222677-137222699 TAGATCGCTGTGACTCTAAGGGG + Intergenic
1062593937 9:137288883-137288905 TTAATCCATTTAACCCTGAGTGG - Intergenic
1203562780 Un_KI270744v1:72129-72151 TTAATCCATTTAACCCTGAGTGG - Intergenic
1185579645 X:1202211-1202233 TTTCTCTCTGTGTCTCTGAGGGG - Intronic
1185652224 X:1656221-1656243 TTAATCCTTGGGACTCAGACTGG + Intergenic
1186323348 X:8453109-8453131 TTAATCCCAGCTACTCTGGGAGG + Intergenic
1186328191 X:8502629-8502651 TTAATCCATTTAACCCTGAGTGG - Intergenic
1186787144 X:12964155-12964177 TTAATCCATTCAACTCTGAGTGG - Intergenic
1186922886 X:14302352-14302374 TTAATCCATTTAACCCTGAGTGG + Intergenic
1187212409 X:17244534-17244556 TTAATCCATTTAACCCTGAGTGG + Intergenic
1187976246 X:24708644-24708666 TTAATCCATTTAACCCTGAGTGG + Intronic
1188367368 X:29332906-29332928 TTAATCCATTTAACCCTGAGTGG + Intronic
1188477584 X:30603616-30603638 TTAATCCATTTAACCCTGAGTGG - Intergenic
1188492609 X:30753615-30753637 TTAATCCATTTAACCCTGAGTGG + Intergenic
1188942784 X:36261585-36261607 TTAATCCATTTAACTCTGAGTGG + Intronic
1189056716 X:37706892-37706914 TTAATCCATTTAACCCTGAGTGG + Intronic
1189210586 X:39278746-39278768 TTAATCCATTTAACCCTGAGTGG - Intergenic
1189341883 X:40210784-40210806 TTAATCCATTTAACCCTGAGTGG + Intergenic
1189506171 X:41613367-41613389 TTAATCCATTTAACCCTGAGTGG - Intronic
1189569877 X:42285292-42285314 TTAATCCATTTAACCCTGAGTGG + Intergenic
1189587125 X:42473669-42473691 TTAATCCATTTAACCCTGAGTGG + Intergenic
1189825145 X:44910758-44910780 TTAATCCATTTAACCCTGAGTGG + Intronic
1189837403 X:45039769-45039791 TTAATCCATTTAACCCTGAGTGG + Intronic
1189956093 X:46276378-46276400 TTAATCCATTTAACCCTGAGTGG - Intergenic
1189968124 X:46394926-46394948 TTAATCCATTTAACCCTGAGTGG + Intergenic
1190171712 X:48116084-48116106 TTAATCCATTTAACCCTGAGTGG - Intergenic
1190184640 X:48222940-48222962 TTAATCCATTTAACCCTGAGTGG - Intronic
1190241107 X:48658958-48658980 TTAATCCATTTAACCCTGAGTGG + Intergenic
1190504986 X:51118842-51118864 TTAATCCATTTAACCCTGAGTGG + Intergenic
1190521294 X:51280705-51280727 TTAATCCATTTAACCCTGAGTGG - Intergenic
1190680754 X:52826445-52826467 TTAATCCATTTAACCCTGAGTGG + Intergenic
1190769794 X:53504803-53504825 TTAATCCATTTAACCCTGAGTGG - Intergenic
1190779503 X:53579683-53579705 TTAATCCATTTAACCCTGAGTGG - Intronic
1190793704 X:53722207-53722229 TTAATCCATTTAACCCTGAGTGG - Intergenic
1190799120 X:53772231-53772253 TTAATCCATTTAACCCTGAGTGG + Intergenic
1190820578 X:53967851-53967873 TTAATCCATTTAACCCTGAGTGG - Intronic
1190839022 X:54128730-54128752 TTAATCCATTTAACCCTGAGTGG + Intronic
1190891384 X:54572264-54572286 TTAATCCATTTAACTCTGAGTGG + Intergenic
1191010279 X:55749770-55749792 TTAATCCATTTAACCCTGAGTGG - Intronic
1191068816 X:56379734-56379756 TTAATCCATTTAACCCTGAGTGG + Intergenic
1191617836 X:63188870-63188892 TTAATCCATTTAACCCTGAGTGG + Intergenic
1191637566 X:63393888-63393910 TTAATCCATTTAACCCTGAGTGG - Intergenic
1191794185 X:65002793-65002815 TTAATCCATTTAACCCTGAGTGG - Intronic
1191835529 X:65457801-65457823 TTAATCCATTTAACCCTGAGTGG - Intronic
1192107271 X:68327514-68327536 TTAATCCATCTAACCCTGAGTGG - Intronic
1192379563 X:70601795-70601817 TTAATCCATTTAACCCTGAGTGG + Intronic
1192463810 X:71340936-71340958 TTAATCCATTTAACCCTGAGTGG + Intergenic
1192476860 X:71451735-71451757 TTAATCCATTTAACCCTGAGTGG + Intronic
1192505274 X:71677272-71677294 TTAATCCATTTAACCCTGAGTGG - Intergenic
1192530109 X:71876505-71876527 TTAATCCATTTAACCCTGAGTGG + Intergenic
1192568054 X:72179711-72179733 TTAATCCATTTAACCCTGAGTGG - Intergenic
1192610374 X:72560297-72560319 TTAATCCATTTAACCCTGAGTGG - Intronic
1192621717 X:72682660-72682682 TTAATCCATTTAACCCTGAGTGG - Intronic
1192761464 X:74099086-74099108 TTAATCCATTTAACCCTGAGTGG - Intergenic
1192769032 X:74167865-74167887 TTAATCCATTTAACCCTGAGTGG - Intergenic
1192794044 X:74412223-74412245 TTAATCCATTTAACCCTGAGTGG + Intergenic
1192813264 X:74568166-74568188 TTAATCCATTTAACCCTGAGTGG + Intergenic
1192892812 X:75407945-75407967 TTAATCCATTTAACCCTGAGTGG - Intronic
1192969539 X:76217412-76217434 TTAATCCATTTAACCCTGAGTGG + Intergenic
1193114733 X:77765950-77765972 TTAATCCATTTAACCCTGAGTGG + Intronic
1193132129 X:77931272-77931294 TTAATCCATTCAACTCTGAGTGG + Intronic
1193207483 X:78765671-78765693 TTAATCCATTTAACCCTGAGTGG - Intergenic
1193269709 X:79515066-79515088 TTAGTCCCAGTGACCATGAGAGG - Intergenic
1193329070 X:80215572-80215594 TTAATCCATTTAACCCTGAGTGG - Intergenic
1193345089 X:80396532-80396554 TTAATCCATTTAACCCTGAGTGG + Intronic
1193362459 X:80591981-80592003 TTAATCCATTTAACCCTGAGTGG - Intergenic
1193372482 X:80713426-80713448 TTAATCCATTTAACTCTGAGTGG - Intronic
1193615400 X:83681910-83681932 TTTATCTCTGGGACTCTGAAGGG + Intergenic
1193924501 X:87466601-87466623 TTAATCCATCTAACCCTGAGTGG - Intergenic
1193942106 X:87688893-87688915 TTAATGCGTGTGACTTTGAAAGG - Intergenic
1194181241 X:90714089-90714111 TTAATCCATTTAACCCTGAGTGG - Intergenic
1194266766 X:91763387-91763409 TAAAACCCTGCAACTCTGAGGGG + Intergenic
1194611390 X:96050547-96050569 TTAATCCATTTAACCCTGAGTGG + Intergenic
1194992173 X:100556396-100556418 TTAATCCATTTAACCCTGAGTGG - Intergenic
1195035894 X:100971988-100972010 TTAATCCATTTAACCCTGAGTGG + Intronic
1196404128 X:115346757-115346779 TTAATCCATTTAACCCTGAGTGG + Intergenic
1197199409 X:123734718-123734740 TTAATCCATTTAACCCTGAGTGG - Intergenic
1197241624 X:124128214-124128236 TTAATCCATTTAACCCTGAGTGG + Intronic
1197455871 X:126674660-126674682 TTAATCCATTTAACCCTGAGTGG - Intergenic
1197736344 X:129851706-129851728 TTAATCCATTTAACCCTGAGTGG - Intergenic
1197897221 X:131327951-131327973 TTAATCCATTTAACCCTGAGTGG - Intronic
1198108543 X:133483468-133483490 TTAATCCATTTAACCCTGAGTGG + Intergenic
1198189036 X:134285601-134285623 TTAATCCATTTAACCCTGAGTGG + Intergenic
1198247045 X:134840094-134840116 TTAATCCATTTAACCCTGAGTGG - Intronic
1198260531 X:134960888-134960910 TTAATCCATTTAACCCTGAGTGG - Intergenic
1198476085 X:136999610-136999632 TTAATCCATTTAACCCTGAGTGG + Intergenic
1198600685 X:138282308-138282330 TTAATCCATTTAACCCTGAGTGG + Intergenic
1199231095 X:145436862-145436884 TTAATCCATTTAACCCTGAGTGG - Intergenic
1199383302 X:147194728-147194750 TCAAACCCTGTGACTTTGAAGGG - Intergenic
1199452489 X:147991917-147991939 TTAATCCATTTAACCCTGAGTGG + Intronic
1199586615 X:149421505-149421527 TTAATCCATTTAACCCTGAGTGG - Intergenic
1199896156 X:152129785-152129807 TTAATCCATTTAACCCTGAGTGG - Intergenic
1200280494 X:154773560-154773582 TTAATCCATTTAACCCTGAGTGG + Intronic
1200324479 X:155223457-155223479 TTAATCCATTTAACCCTGAGTGG + Intronic
1200387377 X:155907532-155907554 TTAATCCATTTAACCCTGAGTGG + Intronic
1200527868 Y:4296018-4296040 TTAATCCATTTAACCCTGAGTGG - Intergenic
1200952798 Y:8917745-8917767 TTAATCCATTTAACCCTGAGTGG + Intergenic
1201282355 Y:12352657-12352679 TTAATCCATTTAACCCTGAGTGG - Intergenic
1201294582 Y:12452855-12452877 TTAATCCATTTAACCCTGAGTGG + Intergenic
1201295989 Y:12463655-12463677 TTAATCCATTTAACGCTGAGTGG + Intergenic
1201440211 Y:14000651-14000673 TTAATCCATTTAACCCTGAGTGG + Intergenic
1201444360 Y:14042057-14042079 TTAATCCATTTAACCCTGAGTGG - Intergenic
1201948372 Y:19536156-19536178 TTAATCCATTTAACCCTGAGTGG - Intergenic