ID: 1058897297

View in Genome Browser
Species Human (GRCh38)
Location 9:109411410-109411432
Sequence GTTAATCCCTGTGACTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058897297_1058897300 0 Left 1058897297 9:109411410-109411432 CCCTCAGAGTCACAGGGATTAAC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1058897300 9:109411433-109411455 CATCCCTGCTGTCACTGTACAGG No data
1058897297_1058897303 5 Left 1058897297 9:109411410-109411432 CCCTCAGAGTCACAGGGATTAAC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058897297 Original CRISPR GTTAATCCCTGTGACTCTGA GGG (reversed) Intronic
901938176 1:12642305-12642327 GTTAAGCTCTGTGCCTCTGTTGG + Intergenic
902907604 1:19570174-19570196 TGTAATCCCAGTTACTCTGAAGG - Intergenic
906212469 1:44019822-44019844 GTTGTCCCCTGTGACTCTGGAGG + Intronic
906503885 1:46362812-46362834 GTGAAGCCCTGTGATGCTGAGGG - Intronic
910879121 1:91906472-91906494 GTTCATCCCTGTGAGGCTGGTGG + Intergenic
912586480 1:110771590-110771612 GTCCATCCCTGAGACTGTGAGGG + Intergenic
917469668 1:175315676-175315698 GCAAATCACTGTGACACTGAGGG - Exonic
917648399 1:177050943-177050965 TTTTTTCCCTGTGAGTCTGATGG - Intronic
919200724 1:194352356-194352378 GTTAATCCCAGCTACTCTGGAGG - Intergenic
923227947 1:231956747-231956769 GTTAGTGCCTCTGAGTCTGAGGG - Intronic
923768272 1:236913115-236913137 TGTAATCCCTGTTACTCTGGAGG + Intergenic
924756394 1:246945093-246945115 TGTAATCCCAGTGACTCTGGAGG - Intergenic
1063514672 10:6683781-6683803 TGTAATCCCAGTGACTCAGAAGG + Intergenic
1065091898 10:22243808-22243830 GTTAATCCCTGAGATCCTCAGGG + Intergenic
1068037289 10:51776702-51776724 GTTAATCCCAGTAACTCAGGAGG + Intronic
1068325964 10:55486761-55486783 TGTAATCTCAGTGACTCTGAAGG - Intronic
1068535851 10:58240896-58240918 CTTAATGCCTGTACCTCTGATGG - Intronic
1068656775 10:59583960-59583982 GTTAACCCCTGTGAGACTAAGGG - Intergenic
1069459119 10:68577685-68577707 GTTAATCCCAGCTACTCTGGAGG + Intronic
1071284550 10:84132430-84132452 GTAAATGCCTGAGACTCTCATGG + Intergenic
1072684867 10:97530314-97530336 TTTAATCCCAGTGACTCAGGAGG + Intronic
1074910036 10:117900079-117900101 CTTAGTCCCTGTGCTTCTGAAGG - Intergenic
1079195309 11:18321873-18321895 GTTCATCCCTGTGTCTCTAGCGG - Intronic
1080693664 11:34581975-34581997 GTGGATCCCTGTGATTCTCAGGG + Intergenic
1080694762 11:34593699-34593721 GTTCATCTCTGTGTCTCTCATGG + Intergenic
1082796580 11:57382204-57382226 TGTAATCCCTGTGACTCAGGAGG - Intergenic
1083601607 11:63952150-63952172 CTTCCTCCCTGTGATTCTGAGGG + Intronic
1086209090 11:84296694-84296716 GGTAATCCCAGTGACTCAGGAGG - Intronic
1088030424 11:105242047-105242069 GCCATTCCCTGTGACTCCGATGG + Intergenic
1089648924 11:119899388-119899410 GTTAATCACTGTGGCTCCCACGG + Intergenic
1089795794 11:120979954-120979976 GTTAATCCCAGCTACTCGGAAGG - Intronic
1090026474 11:123171563-123171585 GTTAATCCCAGCTACTCGGAAGG - Intronic
1096971673 12:55671490-55671512 GTTAATCCCAGCTACTCTGGAGG + Intergenic
1098509936 12:71299744-71299766 GATAATCTCTGTGACTCAGAAGG + Intronic
1099203580 12:79703095-79703117 TGTAATCCCAGTGACTCTGGTGG + Intergenic
1099254349 12:80297451-80297473 GTTAATCCCAGTTACTCAGGAGG - Intronic
1099796743 12:87409578-87409600 GTTCACCCCTGTGCCTCTGCAGG - Intergenic
1100157182 12:91813895-91813917 TGTAATCCCAGTGACTCAGAAGG + Intergenic
1100357794 12:93848465-93848487 CTGAATCCCTGTGATGCTGATGG + Intronic
1104674794 12:130705142-130705164 GCACATCCGTGTGACTCTGAAGG - Intronic
1104862560 12:131931515-131931537 TTTAATCCCAGTGACTCAGGAGG - Intronic
1105333498 13:19440646-19440668 TGTAATCCCAGTGACTCAGAAGG + Intronic
1105922149 13:24973213-24973235 TGTAATCCCAGTGACTCAGAAGG + Intergenic
1106664678 13:31839231-31839253 GTTACACCCTGTGACTTTCATGG + Intergenic
1107123831 13:36822648-36822670 AATAATCCCAGTTACTCTGAAGG - Intronic
1108894282 13:55304352-55304374 TTTTATTCCTGTAACTCTGAAGG + Intergenic
1109580001 13:64318154-64318176 GTTAAACACTGTCACTCTGAAGG + Intergenic
1110194109 13:72766303-72766325 CTGAATCCCTGTGCTTCTGAGGG + Intronic
1113821333 13:113215644-113215666 TTTCATCCATGTGGCTCTGAAGG + Intronic
1113895763 13:113763857-113763879 GTTCTTCCCTGTGTCTCTCATGG - Intronic
1119005165 14:70919138-70919160 CGTAATCCCAGTGACTCTGGAGG - Intronic
1120024147 14:79563524-79563546 GTTAATCCCTGTCAATTTTATGG - Intronic
1122089048 14:99326107-99326129 GTCCATCCCTCTGAATCTGAAGG - Intergenic
1126968802 15:54086410-54086432 GTTATGCCATGTGACTCTTAAGG - Intronic
1130127329 15:81104971-81104993 GTTCCTTCCGGTGACTCTGAGGG + Intronic
1131147466 15:90023560-90023582 TGTAATCCCTGTGACTCAGGTGG + Intronic
1131898634 15:97062605-97062627 TTTAACCACTCTGACTCTGAAGG + Intergenic
1132092257 15:98956194-98956216 TTTGCTCCATGTGACTCTGAGGG + Intronic
1132786682 16:1660885-1660907 GTTAATCCCAGCTACTCCGAAGG + Intronic
1134032761 16:11005739-11005761 GTTAATTCCTGTGAGTCGGAAGG + Intronic
1138381549 16:56606377-56606399 TTGAATCACTTTGACTCTGAGGG - Intergenic
1140918741 16:79517694-79517716 TGTAATCCCTGTGACTTGGAAGG - Intergenic
1141342418 16:83215196-83215218 TGTAATCCCTGTTACTCTGGAGG - Intronic
1142348198 16:89567599-89567621 GCTTCTCCCTGTGCCTCTGAAGG + Intergenic
1146083768 17:29808248-29808270 TGTAATCCCTGTTACTCAGAAGG - Intronic
1147287077 17:39410693-39410715 GTCCATCCCTGTGACGATGAGGG - Exonic
1148936700 17:51168839-51168861 GTTAATCCCAGTTACTCAGGGGG + Intronic
1151317391 17:73331534-73331556 GTTAATCCCAGTTACTCAGGAGG - Intergenic
1156596348 18:38552199-38552221 GCTACTCCCTGTGACTTAGAGGG + Intergenic
1157172374 18:45419650-45419672 TGTAATCCCAGTGACTCTGGAGG + Intronic
1158211225 18:55052706-55052728 GTTATTCCCTGTGAACCTGTTGG + Intergenic
1160316800 18:77855728-77855750 GTTTATGCATTTGACTCTGAAGG + Intergenic
1161084109 19:2326124-2326146 GCTAGGGCCTGTGACTCTGACGG + Intronic
1162840208 19:13350745-13350767 TATAATCCCAGTGACTCTGGAGG + Intronic
1163780585 19:19245199-19245221 CTGAATCCCTGTGAGTTTGAGGG + Intronic
1164264096 19:23595616-23595638 TGTAATCCCAGTTACTCTGAAGG - Intronic
1164384362 19:27760610-27760632 GTTGACCCCTGTCATTCTGATGG - Intergenic
1164392236 19:27834849-27834871 TGTAATCCCAGTGACTCTGGAGG + Intergenic
1166774728 19:45305424-45305446 CTTAATCTCTGTGACTCTTGAGG + Intergenic
925246588 2:2388936-2388958 GTTCTTCCCTGTGACTTTGCAGG + Intergenic
925513715 2:4656349-4656371 ATTAATCTCTGTGACTCTGATGG - Intergenic
926578402 2:14608110-14608132 GTTAATCCCAGTCACTCAGGAGG + Intergenic
928673918 2:33631777-33631799 TGTAATCCCTGTGACTCAGGAGG + Intergenic
930023742 2:47017076-47017098 TGTAATCCCAGTGACTCGGAAGG + Intronic
930722486 2:54650970-54650992 CTTAATTCCTGTCACTATGATGG + Intronic
931353231 2:61511243-61511265 TGTAATCCCTGCTACTCTGAAGG - Intronic
932278467 2:70469454-70469476 GTTAATCCCAGCTACTCTGGAGG - Intronic
934133757 2:88974037-88974059 GTCATTTCCTGTGATTCTGAAGG + Intergenic
934144895 2:89082403-89082425 GTCATTTCCTGTGATTCTGAAGG + Intergenic
934224365 2:90118149-90118171 GTCATTTCCTGTGATTCTGAAGG - Intergenic
935125085 2:100215743-100215765 CCTGCTCCCTGTGACTCTGATGG - Intergenic
935275442 2:101472220-101472242 GTAAATCCCAGCTACTCTGAAGG - Intronic
937818024 2:126275227-126275249 GTTAAAGGCTGAGACTCTGAAGG + Intergenic
938183383 2:129205882-129205904 GCTAATCCCGGTGACTGTGATGG + Intergenic
939104979 2:137938342-137938364 GTTGATCCCTTTGACTCCGTTGG + Intergenic
939391845 2:141578273-141578295 GTTAATCCCTGTTACTCAGGAGG + Intronic
939677874 2:145095068-145095090 GTTAACCTCTGTGTTTCTGAAGG + Intergenic
941447127 2:165615985-165616007 TGTAATCCCAGTGACTCAGAAGG - Intronic
941453499 2:165688435-165688457 GATATACCCTGTGACACTGAGGG - Exonic
942087983 2:172461519-172461541 CTTGGTCCCTGTGGCTCTGAAGG + Intronic
943436872 2:187875892-187875914 GTTAATACGTGTGACTGTGCTGG + Intergenic
946506157 2:220303364-220303386 GTTAATCTGGGTGACCCTGAAGG + Intergenic
946766406 2:223044865-223044887 TGTAATCCCAGTCACTCTGAAGG + Intergenic
947966844 2:234289279-234289301 CTGAACTCCTGTGACTCTGAGGG + Intergenic
1168957000 20:1841323-1841345 GTGACTTCCTGTGGCTCTGATGG + Intergenic
1170590700 20:17769266-17769288 GGTCTTCCCTGGGACTCTGAGGG - Intergenic
1173160394 20:40647923-40647945 GTGAGTGCCTGTGACTGTGAGGG - Intergenic
1173410442 20:42804798-42804820 GATAAACCATGTGAATCTGAAGG - Intronic
1174015164 20:47481923-47481945 GATAACCCCTGTGACTGTGTGGG - Intergenic
1174283726 20:49457460-49457482 GTGAATCAATGTGATTCTGATGG - Intronic
1176739546 21:10587968-10587990 TGTAATCCCAGTGACTCAGAAGG - Intronic
1177118556 21:17114167-17114189 GTGGATGCCTGTGACTCTGATGG - Intergenic
1178105414 21:29313557-29313579 GTTTATCCATTTGACTCTGATGG - Intronic
1178336491 21:31748402-31748424 GTTCATCCTTGTGACTTTCAAGG + Intergenic
1178407838 21:32339114-32339136 TTTAATCCCAGTTACTCTGGAGG - Intronic
1178743519 21:35225879-35225901 GTTACTCACAGTGGCTCTGAGGG + Intronic
1178942584 21:36918814-36918836 GTTAACCCCTGTAACTTTTAGGG - Intronic
1182510036 22:30812781-30812803 TTTACTCCTTGTTACTCTGATGG + Intronic
1184171370 22:42761667-42761689 GTGAATCCCAGTGACTCTCCTGG + Intergenic
949774991 3:7622843-7622865 GTTATTTCCTCTGACCCTGATGG + Intronic
950453606 3:13079463-13079485 TTTAATCTCTGGGACTCTGGGGG + Intergenic
954288796 3:49638125-49638147 GATAGTCCCTCTGATTCTGATGG + Intronic
954427228 3:50449802-50449824 CTGAATGCCTGTGTCTCTGATGG - Intronic
956403907 3:68908225-68908247 GTTAACCTCTGTGTCTCTTAGGG - Intronic
959350493 3:105256090-105256112 GTTAATTTCTGTGGCTGTGATGG - Intergenic
960433500 3:117598568-117598590 GTTAGCCCCTGTGGCTCTGGTGG + Intergenic
962095690 3:132290177-132290199 ATTGATCCCTGTGATGCTGAAGG + Intergenic
962199430 3:133389255-133389277 GTTCATCCCTGAGACTCCCAGGG - Intronic
962571407 3:136716992-136717014 TTTGATCCCTGTGACAATGATGG - Intronic
962611283 3:137078657-137078679 TTTATTCTCTGTGACTCTGGAGG + Intergenic
963979826 3:151525145-151525167 TGTAATCCCAGTGACTCAGAAGG - Intergenic
965016744 3:163168009-163168031 GTAAACCCCTGTGGCTGTGATGG + Intergenic
966957284 3:184895753-184895775 TTTAATCCCAGCTACTCTGAAGG - Intronic
967156832 3:186700614-186700636 TGTAATCCCTGTTACTCTGGGGG - Intergenic
971626223 4:28923489-28923511 GTCTAGCACTGTGACTCTGAAGG + Intergenic
972392304 4:38625163-38625185 TGTAATCCCTGTTACTCTGGAGG + Intergenic
973026659 4:45282299-45282321 ATTAATCTTTTTGACTCTGATGG - Intergenic
975800410 4:78055525-78055547 TTTAATCCCAGGTACTCTGAAGG - Intergenic
977396618 4:96479031-96479053 CTCCATCCCTGTGACTCTGCAGG - Intergenic
977610948 4:99030487-99030509 CTTAATCCCTTTGGCTGTGATGG + Intronic
982797472 4:159663489-159663511 CCTCATCCCTGTGACTCTGCAGG + Intergenic
985529238 5:424146-424168 GTTAACCCATGTGTCTCTGGTGG + Intronic
985529256 5:424221-424243 GTTAACCCATGTGTCTCTGGTGG + Intronic
985529316 5:424444-424466 GTTAACCCATGTGTCTCTGGTGG + Intronic
989241031 5:39202880-39202902 GTTTGGCCCTGTGACTCTGAAGG + Exonic
989400143 5:40999953-40999975 ATTAATCCCTTAAACTCTGATGG - Intronic
990174312 5:53090400-53090422 GGGAATCCCTGAGGCTCTGAAGG - Intronic
991342033 5:65622285-65622307 GTTAATCCCAGTTACTCAGGAGG - Intronic
992865093 5:80950143-80950165 GTTTCTCCCTGTGACTCCAAGGG + Intergenic
996132759 5:119801785-119801807 ATCAATCCCTGTGACTTTCAAGG - Intergenic
1000647135 5:163772534-163772556 ATAAATCCCTGTGGCTCTGTGGG + Intergenic
1002271709 5:178076713-178076735 GTTAGTCCCAGCTACTCTGAAGG + Intergenic
1002361313 5:178673499-178673521 TGTAATCCCAGTGACTCTGGAGG + Intergenic
1002546981 5:179955345-179955367 GTCAATCCCTGTTCCTCTCACGG + Exonic
1003462007 6:6338015-6338037 GTAAATCCCAGTGACTCAGGAGG + Intergenic
1006347452 6:33494441-33494463 TGTAATCCCAGTGACTCAGAAGG + Intergenic
1006365573 6:33613242-33613264 GTTTTTCACTGTGACTGTGAAGG + Intergenic
1006806041 6:36789871-36789893 GTTAATCTCAGTGGATCTGAAGG - Intronic
1007017850 6:38487457-38487479 TGTAATCCCAGCGACTCTGAAGG + Intronic
1007998225 6:46331265-46331287 TGTAATCCCAGTGACTCTGGAGG - Intronic
1008050520 6:46895948-46895970 AATAATCCCTGTGACTCTTCAGG - Intronic
1009315207 6:62210450-62210472 TGTAATCCCAGTGACTCTGGGGG - Intronic
1011629603 6:89311252-89311274 TTTACTCCCTGTGAGTCAGAGGG - Intronic
1015417596 6:132967542-132967564 ATTCATCACTGTGTCTCTGAGGG - Intergenic
1015838679 6:137451814-137451836 TGTAATCCCAGTGACTCTGGAGG - Intergenic
1015903877 6:138096124-138096146 GACAATCCCTGTCACTCGGATGG + Intronic
1020161588 7:5776777-5776799 TGTAATCCCTGTTACTCTGGAGG + Intronic
1021633366 7:22667564-22667586 GAAAAGCCCTGTGACTCTGAGGG + Intergenic
1025389215 7:59341810-59341832 GTTAAACTCTGTGAGTTTGAAGG - Intergenic
1029356817 7:100058246-100058268 GTTACTCCCTGTGAGCCTAAAGG + Intronic
1030833936 7:114260009-114260031 GCTAATCCCAGCTACTCTGAAGG - Intronic
1031850484 7:126857274-126857296 GTTATTGCCTGTGATTCTGCAGG + Intronic
1034685859 7:152970798-152970820 GTTGCTACCTGTGACACTGAGGG + Intergenic
1038754995 8:30332448-30332470 TTTAATCCCAGTTACTCTGGAGG - Intergenic
1040435355 8:47385558-47385580 GTGAATTCCTGTGACTGTGCTGG - Intronic
1043631525 8:82341169-82341191 TATAATCCCTGTTACTCTGGAGG - Intergenic
1044364961 8:91334007-91334029 CTTCATCCCTGACACTCTGAGGG - Intronic
1045709849 8:104970426-104970448 TGTAATCCCTGTTACTCTGGAGG + Intronic
1052589978 9:30479458-30479480 TTTAATCCCAGCTACTCTGAGGG + Intergenic
1057529656 9:95832571-95832593 CTTCAGCCCTGTGTCTCTGAGGG - Intergenic
1057744728 9:97741796-97741818 GTTAATCTCTGTGAGCCTGGAGG + Intergenic
1058554666 9:106154115-106154137 TTTAATACCTGTAACTCAGAAGG + Intergenic
1058897297 9:109411410-109411432 GTTAATCCCTGTGACTCTGAGGG - Intronic
1060094221 9:120773063-120773085 TATAATCCCAGTGACTCGGAAGG + Intronic
1062479762 9:136745831-136745853 GAGAATCCCTGTGAGTCTGACGG - Exonic
1203593353 Un_KI270747v1:93518-93540 GTTAAACCCTGTGACTTGAATGG - Intergenic
1185579646 X:1202212-1202234 GTTTCTCTCTGTGTCTCTGAGGG - Intronic
1188785641 X:34343103-34343125 ATTAATCCCCTTGAATCTGAAGG - Intergenic
1189535185 X:41927945-41927967 GTTCATACCTGTGACTCCAAAGG + Intergenic
1190241712 X:48661796-48661818 TGTAATCCCAGTGACTTTGAAGG + Intergenic
1190263429 X:48813974-48813996 GTCAAACCCTGTGACACTGGAGG - Intronic
1190373426 X:49764870-49764892 TTTGATTCCTGTGACTCTGAAGG + Intergenic
1193615399 X:83681909-83681931 CTTTATCTCTGGGACTCTGAAGG + Intergenic
1193750263 X:85333785-85333807 GTCAATCACTGAGAATCTGATGG - Intronic
1198372174 X:136000861-136000883 TTTAATCCCAGTGACTCAGGAGG + Intronic
1199383303 X:147194729-147194751 CTCAAACCCTGTGACTTTGAAGG - Intergenic