ID: 1058897298

View in Genome Browser
Species Human (GRCh38)
Location 9:109411411-109411433
Sequence GGTTAATCCCTGTGACTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058897298_1058897303 4 Left 1058897298 9:109411411-109411433 CCTCAGAGTCACAGGGATTAACC 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data
1058897298_1058897300 -1 Left 1058897298 9:109411411-109411433 CCTCAGAGTCACAGGGATTAACC 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1058897300 9:109411433-109411455 CATCCCTGCTGTCACTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058897298 Original CRISPR GGTTAATCCCTGTGACTCTG AGG (reversed) Intronic
900621539 1:3589782-3589804 GTTTTATCTCTGTGACTTTGTGG + Intronic
902115275 1:14116192-14116214 TGTTAATCCCTGAGACAATGGGG + Intergenic
909057897 1:70844824-70844846 TGTTAATCCCTATGACAATGTGG + Intergenic
909096042 1:71290638-71290660 TGTTAATCCCTGAGACAATGGGG + Intergenic
909765047 1:79345220-79345242 GGAAAATTCCTGTGACTCAGAGG + Intergenic
910767665 1:90798575-90798597 AGTTGATCCCTGAGTCTCTGGGG + Intergenic
910888368 1:91990728-91990750 GGTGAAAACCTGTGACTCTAAGG + Intronic
914004671 1:143721914-143721936 CTGTAATCCCAGTGACTCTGTGG - Intergenic
921886954 1:220316786-220316808 GGTTAATCCATCTGCCTTTGTGG - Intergenic
922447287 1:225708112-225708134 GGTTCATCCCGATGATTCTGAGG - Intergenic
923227948 1:231956748-231956770 GGTTAGTGCCTCTGAGTCTGAGG - Intronic
924162739 1:241250833-241250855 GGCTAAGCCCTGTGGCTCTCTGG + Intronic
924798217 1:247308428-247308450 GGTTTGTCCCTGTGTGTCTGTGG - Intronic
1067026032 10:42845071-42845093 GGATCATCCCTGTGTCTCTTGGG + Intergenic
1067074439 10:43166744-43166766 GTTTATTCCCTTTGACTTTGGGG - Intronic
1068540636 10:58290985-58291007 CTTTAATACCTGTGTCTCTGTGG + Intergenic
1070629966 10:78077494-78077516 GGATAGCCCCTTTGACTCTGGGG + Intergenic
1077403070 11:2368532-2368554 GGCTATACTCTGTGACTCTGTGG - Intergenic
1079093564 11:17496820-17496842 GGAGAAGCCGTGTGACTCTGGGG + Intronic
1079238634 11:18706773-18706795 GGTTAATATCTGGGACGCTGCGG - Intronic
1079401464 11:20109789-20109811 AGTTCTTCCCAGTGACTCTGAGG - Intronic
1081479968 11:43476816-43476838 TGTTAATCCCTGAGACCATGGGG - Intronic
1083161561 11:60857575-60857597 GGTTAAGCCCAGGGACTCTGGGG + Intergenic
1083506223 11:63160170-63160192 GGTTAATCCCTAAGACAATGGGG + Intronic
1083863748 11:65442189-65442211 GCTGAATGCCTGTGTCTCTGGGG - Intergenic
1088497018 11:110441798-110441820 AGTTAATCCCTGAGATACTGGGG + Intronic
1088957337 11:114624237-114624259 GGGTAATCACTGTGACCCGGTGG + Intergenic
1089389885 11:118093525-118093547 GGCTCCTCCATGTGACTCTGTGG + Intronic
1096173720 12:49496557-49496579 GCTCAATCCCTGTGGCTCTGTGG - Intronic
1096982952 12:55738743-55738765 GGTTAATTCCTGAAACTCAGGGG + Intergenic
1097395611 12:59070480-59070502 AGTTAATCCCAGTGATTATGTGG + Intergenic
1101753142 12:107599848-107599870 GGTATTTCCCTGAGACTCTGAGG + Intronic
1102648163 12:114417428-114417450 GGCTAATGTCTGTGACTCAGGGG - Intergenic
1113345604 13:109474993-109475015 GGTTAATCCCTGGGAGTTTAGGG - Intergenic
1117091318 14:52253637-52253659 CTTTAATCCCTGTACCTCTGAGG + Intergenic
1120553461 14:85901061-85901083 AGTGAATCCCTGTGATTTTGAGG + Intergenic
1122332284 14:100929963-100929985 GATTAAACCCTGTAACTCTGAGG + Intergenic
1122333420 14:100945693-100945715 GATTAAACCCTATAACTCTGAGG + Intergenic
1124658113 15:31524817-31524839 GGTTGATCACTCAGACTCTGTGG + Intronic
1125672013 15:41480575-41480597 GGCTAAAGCCTTTGACTCTGTGG - Exonic
1130127328 15:81104970-81104992 GGTTCCTTCCGGTGACTCTGAGG + Intronic
1132204933 15:99979988-99980010 GGTTAATTTCTGTGACTATTTGG + Intronic
1135029905 16:19030070-19030092 GAATACTCCCTGTGCCTCTGGGG + Intronic
1141020085 16:80486926-80486948 GGTTCATTACTGAGACTCTGTGG - Intergenic
1143184525 17:5002221-5002243 GGTTACTGACTGTGACTTTGGGG + Intronic
1146563460 17:33891588-33891610 GGTTAATCCCATAGACACTGAGG + Intronic
1148576518 17:48715637-48715659 GGTTAATCCTTGGGATGCTGAGG - Intergenic
1148936699 17:51168838-51168860 AGTTAATCCCAGTTACTCAGGGG + Intronic
1149187080 17:54011154-54011176 CGTTAATCTCTGTAACTATGAGG - Intergenic
1152195227 17:78914174-78914196 GGTTATAACCTGTGCCTCTGAGG - Intronic
1153225859 18:2899223-2899245 GGTAGATCCCTCTGCCTCTGGGG - Intronic
1156220566 18:35047049-35047071 GGACACTCCCTGTGACTTTGGGG + Intronic
1156358446 18:36362459-36362481 GGTTTATACCTGTTAGTCTGAGG + Intronic
1157296853 18:46451279-46451301 GGATAAAACCTGTGACTCTGTGG - Intronic
1159178708 18:64873344-64873366 AGATAATTCCTGTGACTGTGTGG - Intergenic
1160717891 19:584647-584669 GGGTGATGCCTGGGACTCTGCGG - Intergenic
1160837454 19:1131575-1131597 GGCAAATCCCTGTGGCTCTGTGG - Intronic
1162838360 19:13336865-13336887 GGTTAAGCCCATGGACTCTGGGG - Intronic
1164120631 19:22262011-22262033 GGTGAATGCCTGGGCCTCTGGGG + Intergenic
1164753286 19:30671488-30671510 GCTTCATCCAAGTGACTCTGGGG + Intronic
1166335124 19:42101302-42101324 GGTTAATCTCTGAGGTTCTGGGG - Intronic
1167724864 19:51204079-51204101 GTTTAATTCCTGTGACTTTGTGG - Intergenic
925188627 2:1865988-1866010 GGCTAAACCCAGTGCCTCTGAGG - Intronic
925842408 2:8004979-8005001 GGACCATCTCTGTGACTCTGTGG - Intergenic
932217363 2:69975583-69975605 GGTTTCTCCCTGTGGTTCTGTGG + Intergenic
935781175 2:106510963-106510985 TGTTAATTGCAGTGACTCTGGGG + Intergenic
937075671 2:119104550-119104572 AGTTTGTCCCTGTGAGTCTGAGG - Intergenic
937471626 2:122178785-122178807 GGTAAATCCCTGTCACCCTTGGG + Intergenic
938712146 2:133984111-133984133 GGTTCGACCCTGTGGCTCTGAGG + Intergenic
938946027 2:136212745-136212767 AGTGAATACCTGGGACTCTGGGG - Intergenic
939050172 2:137298493-137298515 TGTTAATCCCTGAGACCATGGGG + Intronic
940428485 2:153558057-153558079 TGTTCATCACTGTGACTATGTGG + Intergenic
943036942 2:182758862-182758884 GCTTATTCCCTGAGAATCTGGGG + Exonic
945932525 2:215869687-215869709 GCTTTATCACTGAGACTCTGCGG + Intergenic
946077108 2:217083462-217083484 GGCTCATCCATGGGACTCTGAGG - Intergenic
946224294 2:218254821-218254843 GCTTGGTCCCTGAGACTCTGTGG + Intergenic
946475429 2:220002104-220002126 TGTTGAACACTGTGACTCTGGGG + Intergenic
947966843 2:234289278-234289300 GCTGAACTCCTGTGACTCTGAGG + Intergenic
1169294370 20:4380754-4380776 TGTTACTCCCTTTGTCTCTGGGG + Intergenic
1169999309 20:11596813-11596835 GGTTAATCCCCAAGACTTTGGGG - Intergenic
1172916995 20:38450662-38450684 GGAAAAGCCCTGTGGCTCTGGGG + Intergenic
1174015165 20:47481924-47481946 CGATAACCCCTGTGACTGTGTGG - Intergenic
1174707833 20:52675163-52675185 GATTAGTCCCTGTGTCTCTCAGG - Intergenic
1178743518 21:35225878-35225900 GGTTACTCACAGTGGCTCTGAGG + Intronic
1178909372 21:36661934-36661956 GATTGATCACTGTGACTTTGAGG + Intergenic
950200411 3:11038311-11038333 GGTAAATAACTGTGACTGTGGGG + Exonic
950453605 3:13079462-13079484 CTTTAATCTCTGGGACTCTGGGG + Intergenic
961697450 3:128715389-128715411 GGTTCATCTCTGTGTCCCTGTGG + Intergenic
964426668 3:156561506-156561528 TGTTAATCCCTAAGACCCTGGGG + Intergenic
965766470 3:172135935-172135957 TGTTAATCACTGGGACTGTGAGG - Intronic
966466319 3:180234173-180234195 TGTTAATCCCTGAGACAATGGGG - Intergenic
967156833 3:186700615-186700637 CTGTAATCCCTGTTACTCTGGGG - Intergenic
970344085 4:15136252-15136274 TGTTAATCCCTGAGACAATGGGG - Intergenic
975589900 4:75989574-75989596 GGTTAATCGCTGAGCCTATGTGG - Intronic
984429745 4:179633672-179633694 GGTTTAACCCTGGGATTCTGGGG - Intergenic
986022992 5:3822150-3822172 GGTAAGTGCCTGTGACTCTCTGG + Intergenic
996873353 5:128216003-128216025 TGTTAACTCTTGTGACTCTGGGG - Intergenic
997999178 5:138610618-138610640 GGATAAAACATGTGACTCTGTGG - Intergenic
1000647134 5:163772533-163772555 TATAAATCCCTGTGGCTCTGTGG + Intergenic
1001385111 5:171332093-171332115 GGTCCATCCCTGTGCCTCTCAGG + Intergenic
1009315208 6:62210451-62210473 CTGTAATCCCAGTGACTCTGGGG - Intronic
1010800564 6:80169420-80169442 GTGTTATCCCTGTGACTTTGAGG - Intronic
1011855093 6:91679714-91679736 ATTTTACCCCTGTGACTCTGTGG - Intergenic
1012826424 6:104151923-104151945 TGTTAATCCCCGTGACCATGGGG - Intergenic
1016998056 6:149974987-149975009 AGTTACTCACTGTCACTCTGAGG + Intergenic
1017258080 6:152357174-152357196 GGTTAATCCTTACAACTCTGTGG + Intronic
1021633365 7:22667563-22667585 AGAAAAGCCCTGTGACTCTGAGG + Intergenic
1022637488 7:32150578-32150600 GATTAATCCCTTGGATTCTGAGG + Intronic
1026408999 7:70099475-70099497 CTTTAAGCCCTGTGACTCAGGGG + Intronic
1027937781 7:84632020-84632042 TGTTAATCCCTAAGACTATGGGG + Intergenic
1028390436 7:90310679-90310701 GGTTCATGCCTGTGTCTCTGTGG + Exonic
1028448488 7:90952479-90952501 GGATTATCCCTTTTACTCTGGGG + Intronic
1039056221 8:33539033-33539055 TGTTGATCTGTGTGACTCTGAGG + Intergenic
1042379784 8:68100489-68100511 GGTTGATCCTTTTGACTCTGTGG + Intronic
1044364962 8:91334008-91334030 GCTTCATCCCTGACACTCTGAGG - Intronic
1045551820 8:103179867-103179889 GGCTTATCCCTGAGACTCTAAGG - Intronic
1045895407 8:107210088-107210110 GGTAAATCTCTCTGATTCTGGGG + Intergenic
1048359194 8:133681233-133681255 GGAGAATCCCTGAGATTCTGTGG + Intergenic
1054813373 9:69452223-69452245 GGTTAATCCCATTGGCCCTGAGG + Exonic
1054937294 9:70701479-70701501 ATTTAATGCCTGTGACTGTGGGG + Intronic
1058897298 9:109411411-109411433 GGTTAATCCCTGTGACTCTGAGG - Intronic
1061165872 9:128921957-128921979 CGCCATTCCCTGTGACTCTGAGG - Exonic
1186671029 X:11767374-11767396 GGTTCATGCCTGTGAGACTGGGG + Intronic
1186742554 X:12533939-12533961 TGTTAATCCCTGAGACAGTGGGG + Intronic
1195683418 X:107565184-107565206 GGTTCAACCCTGGGACTCTTTGG + Intronic
1200702258 Y:6412240-6412262 GATAAGTCCCTGTGACTTTGTGG - Intergenic
1201031853 Y:9752458-9752480 GATAAGTCCCTGTGACTTTGTGG + Intergenic
1201985215 Y:19958113-19958135 GGTTAACCTCTGTGAGGCTGGGG + Intergenic