ID: 1058897303

View in Genome Browser
Species Human (GRCh38)
Location 9:109411438-109411460
Sequence CTGCTGTCACTGTACAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058897290_1058897303 25 Left 1058897290 9:109411390-109411412 CCAAGACCCCTATTTCTAACCCC 0: 1
1: 0
2: 0
3: 22
4: 200
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data
1058897293_1058897303 17 Left 1058897293 9:109411398-109411420 CCTATTTCTAACCCCTCAGAGTC 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data
1058897292_1058897303 18 Left 1058897292 9:109411397-109411419 CCCTATTTCTAACCCCTCAGAGT 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data
1058897298_1058897303 4 Left 1058897298 9:109411411-109411433 CCTCAGAGTCACAGGGATTAACC 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data
1058897297_1058897303 5 Left 1058897297 9:109411410-109411432 CCCTCAGAGTCACAGGGATTAAC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data
1058897296_1058897303 6 Left 1058897296 9:109411409-109411431 CCCCTCAGAGTCACAGGGATTAA 0: 1
1: 0
2: 1
3: 75
4: 1840
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data
1058897291_1058897303 19 Left 1058897291 9:109411396-109411418 CCCCTATTTCTAACCCCTCAGAG 0: 1
1: 0
2: 1
3: 12
4: 168
Right 1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058897303 Original CRISPR CTGCTGTCACTGTACAGGAC AGG Intronic
No off target data available for this crispr