ID: 1058901575

View in Genome Browser
Species Human (GRCh38)
Location 9:109446874-109446896
Sequence TTGGATGAGATCAACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058901570_1058901575 15 Left 1058901570 9:109446836-109446858 CCTTGGGCTTCAGGGTCTTCACC 0: 1
1: 1
2: 9
3: 45
4: 385
Right 1058901575 9:109446874-109446896 TTGGATGAGATCAACCATCTTGG No data
1058901567_1058901575 26 Left 1058901567 9:109446825-109446847 CCTTTCTTTCACCTTGGGCTTCA 0: 1
1: 0
2: 3
3: 27
4: 354
Right 1058901575 9:109446874-109446896 TTGGATGAGATCAACCATCTTGG No data
1058901566_1058901575 27 Left 1058901566 9:109446824-109446846 CCCTTTCTTTCACCTTGGGCTTC 0: 1
1: 0
2: 2
3: 26
4: 462
Right 1058901575 9:109446874-109446896 TTGGATGAGATCAACCATCTTGG No data
1058901574_1058901575 -6 Left 1058901574 9:109446857-109446879 CCTGCTGAGTGAAGGGCTTGGAT 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1058901575 9:109446874-109446896 TTGGATGAGATCAACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058901575 Original CRISPR TTGGATGAGATCAACCATCT TGG Intronic
No off target data available for this crispr