ID: 1058904401

View in Genome Browser
Species Human (GRCh38)
Location 9:109469970-109469992
Sequence GGGGACTGCGCCACGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058904401_1058904409 6 Left 1058904401 9:109469970-109469992 CCCTTCTCCGTGGCGCAGTCCCC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1058904409 9:109469999-109470021 CAATTCTTCCCTATGAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058904401 Original CRISPR GGGGACTGCGCCACGGAGAA GGG (reversed) Intronic
903967330 1:27099042-27099064 GGGGAGTGCCCCAGGGACAAGGG + Exonic
906018439 1:42604688-42604710 GGGGACTGGGCATTGGAGAAAGG - Intronic
906875518 1:49533968-49533990 GGGGATTTCGCCAAAGAGAAGGG + Intronic
907424675 1:54372175-54372197 GAGAACTGAGCCACAGAGAAGGG - Intronic
907710202 1:56873713-56873735 GTGGACTGAGCCAGGGAGAGAGG + Intronic
915109391 1:153553431-153553453 GGCGACAGAGCCAGGGAGAATGG - Intergenic
922654331 1:227367898-227367920 GGAGACTGAGGCAGGGAGAATGG + Intergenic
923714371 1:236412314-236412336 AGGGATTGGGCTACGGAGAAGGG - Intronic
924622388 1:245673229-245673251 GGGGACTGGGCCTCGGGGACTGG - Intronic
1067773469 10:49144332-49144354 GGGGACTGCGCCAGGGAGTGTGG + Intergenic
1074871199 10:117577460-117577482 GGTGACTGCGCCAGGGACAAAGG - Intergenic
1075055522 10:119215536-119215558 GGGGGCTGCACCATGGAGGAGGG + Intronic
1079117590 11:17650451-17650473 TGAGCCTGCACCACGGAGAATGG - Intergenic
1085084786 11:73659780-73659802 GGGGACTGAGGCTCAGAGAATGG - Intronic
1087586813 11:100131933-100131955 GGGCACTGAGGCAAGGAGAAAGG + Intronic
1090186008 11:124739728-124739750 GGGGATTGCGCCCGGGAGGATGG + Intergenic
1091015842 11:132050144-132050166 GGGGACTGGGGAAGGGAGAAGGG + Intronic
1091710545 12:2737228-2737250 GGGGACTCCGCCAGGGAGGGTGG - Intergenic
1092304300 12:7283487-7283509 AGGGACTGTGCCACGAGGAACGG + Intergenic
1094757798 12:33492501-33492523 GGGGACTGTGCCATGAGGAATGG + Intergenic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096482548 12:51951995-51952017 GGCGGCTGCGCCTCGGAGATCGG - Intronic
1103871648 12:124096534-124096556 GTGAACTGATCCACGGAGAAAGG - Intronic
1106983921 13:35322304-35322326 AGGGACTGTGCCATGGGGAACGG - Intronic
1109291046 13:60475243-60475265 GGGGACTGCTTAAGGGAGAAGGG - Intronic
1112354322 13:98661392-98661414 GGGGAGTGGGCCAGGGAGAAGGG + Intergenic
1118248664 14:64136905-64136927 GGGGACTGAGCCAAGGGAAAAGG + Intronic
1118276216 14:64388186-64388208 GGGGACTGCGGGACGGAAGAGGG - Intronic
1121840470 14:97129733-97129755 GGGGACTGTGCCCCAGAAAAGGG - Intergenic
1122066256 14:99176003-99176025 GGGGACTGCGCCACGGCCTCCGG + Exonic
1126554016 15:49966054-49966076 AGGGACTGTGCCATGAAGAACGG + Intronic
1127317943 15:57815303-57815325 AGGGACTGTGCCATGAAGAATGG - Intergenic
1130093239 15:80838323-80838345 GGAGGCAGCGCCAAGGAGAAAGG - Intronic
1130093612 15:80840429-80840451 GGAGGCAGCGCCAAGGAGAAAGG - Intronic
1131195710 15:90352887-90352909 GGAGACAGCGCCACTGAGGAGGG - Intronic
1132414508 15:101610779-101610801 GAGGACTGCGCCTGGGAGGAGGG - Intergenic
1133027041 16:2993041-2993063 GGGGACAGAGCCAAAGAGAATGG - Intergenic
1133470134 16:6066968-6066990 GGGGAGGGCGGCAGGGAGAAAGG + Intronic
1139306720 16:65992649-65992671 GGAGACTGCGGCCCAGAGAAAGG + Intergenic
1139345013 16:66297183-66297205 GGGGCCTGGCCCTCGGAGAATGG + Intergenic
1141421656 16:83921568-83921590 GGGGACTGAGGCATGGAGAAGGG - Exonic
1143125665 17:4639759-4639781 GGGGACTGAGCCAGAGAGAGAGG + Intronic
1143238260 17:5421496-5421518 GGGGACTGCACCACCAAGAACGG + Intronic
1143402810 17:6657064-6657086 GGGGACTGAGCCAGAGAGAGAGG - Intergenic
1152659228 17:81534780-81534802 GGGGGCTGTGCCAAGCAGAAGGG + Intronic
1159744011 18:72209460-72209482 GGACCCTGCGCCGCGGAGAAGGG - Intergenic
1161370332 19:3907790-3907812 GGGGACGGCACGACGGAGGACGG + Exonic
1161403016 19:4077259-4077281 GGGTACTGGGCCACAGAGAGAGG - Intergenic
1161959414 19:7515750-7515772 GGGGACAGAGACACAGAGAAAGG + Intronic
1164454587 19:28396684-28396706 GGGGACTGCTCCTCGCAGAGCGG - Intergenic
1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG + Intergenic
1167269575 19:48499510-48499532 GTGGACAGCGCCTCGTAGAAAGG + Exonic
1167608903 19:50496780-50496802 GTGGGCTGGGCCACGGAGGAGGG - Intergenic
1168573365 19:57488431-57488453 TGGGACTGGGCCACAGAGGAGGG + Intronic
1168574782 19:57500561-57500583 TGGGACTGGGCCACAGAGGAGGG + Intronic
934921613 2:98348542-98348564 GGGGAGGGCGGGACGGAGAAGGG - Intronic
935896798 2:107747366-107747388 TGGGACTGGGCCCCGGAGCAGGG + Intergenic
940883667 2:158969875-158969897 GGGAACAACGCCACTGAGAACGG - Intronic
942450994 2:176107920-176107942 GGGGGCTGCGGCCCGGCGAACGG - Exonic
948109069 2:235440132-235440154 TGGGACTGTCCCACGGAGATTGG + Intergenic
949014745 2:241702638-241702660 GGGGACTGCGGCGCGGAGGCGGG + Intronic
1168810090 20:699543-699565 GGGGGCTGCACCAGGAAGAAAGG + Intergenic
1169073930 20:2750201-2750223 GGGGACTTTGCCCCGGGGAAGGG - Intronic
1170856551 20:20061735-20061757 GGGGACTACAGCAGGGAGAATGG - Intronic
1171106496 20:22438482-22438504 GGGGGCTGAGCCCCGGAGCAGGG + Intergenic
1176662526 21:9651628-9651650 GGTGACTGGGCCAGGGTGAATGG + Intergenic
1180871173 22:19148189-19148211 GGGGACTGCTCCACGGATGGTGG - Intergenic
1183261243 22:36797312-36797334 GAGGACTGAGCCAGGGAAAAGGG + Intergenic
962893995 3:139697860-139697882 GGGGACTGTCCCAAGGAGAAGGG - Intergenic
964965061 3:162481936-162481958 GGGGACTGTGCCATGCAGCATGG - Intergenic
967989498 3:195120725-195120747 AGTGACGGAGCCACGGAGAAGGG - Intronic
968008875 3:195260266-195260288 AGGGACCGCGCCGCGGAGGAGGG + Intronic
969536064 4:7756732-7756754 GGGGACTGCGCCGAGGAGCCGGG + Intergenic
969616477 4:8255847-8255869 GGGCACGGGGCCACAGAGAAGGG + Intergenic
977774366 4:100900381-100900403 GGGGACTGTGCCATGAGGAACGG + Intergenic
980510382 4:133778791-133778813 GGGGCCTTGGCCACAGAGAATGG - Intergenic
983793112 4:171823343-171823365 GGGGACAGTCCCAAGGAGAATGG + Intronic
985412869 4:189704897-189704919 GGTGACTGGGCCAGGGTGAATGG - Intergenic
998402073 5:141853270-141853292 GGGCACTGCGGCAGGGAGGAGGG + Exonic
998648408 5:144090220-144090242 GCGGACTGCCCCATGGAGATGGG - Intergenic
999565202 5:152851923-152851945 GGGGACTCAGTCATGGAGAAGGG - Intergenic
999878140 5:155831304-155831326 GGAGACGGAGGCACGGAGAAAGG - Intergenic
1002033384 5:176447428-176447450 GGGGACTGCCTCGAGGAGAAGGG + Intergenic
1002895982 6:1380521-1380543 GGGGAGTGGACCACGGAGCATGG - Intergenic
1003102034 6:3184021-3184043 GAGGACTGACCCAGGGAGAAGGG - Intergenic
1004154401 6:13154779-13154801 GAGGAGTGAGCCACCGAGAAAGG - Intronic
1005636363 6:27757318-27757340 GGCCACTGCGCCACGCAGATTGG - Intergenic
1010973388 6:82287029-82287051 GGAGACTGAGGCAAGGAGAATGG - Intergenic
1012417342 6:99024927-99024949 GGGGTCTGTGCCATGAAGAAGGG - Intergenic
1014523960 6:122478955-122478977 AGGGACTGTGCCATGAAGAATGG - Intronic
1015369440 6:132434586-132434608 GAGGACTGTGACACAGAGAATGG + Intergenic
1019451744 7:1102303-1102325 TGGGACTGCGCGGTGGAGAAGGG - Intronic
1019547719 7:1586429-1586451 GGGGACTGCGGCCCCCAGAAAGG + Intergenic
1019841601 7:3451451-3451473 GGGGACTTGGACACGGGGAAGGG + Intronic
1021562451 7:21981933-21981955 TGGGACAGCGCGAAGGAGAAAGG - Intergenic
1026978720 7:74514358-74514380 GGGGACTGGGCCGGGTAGAATGG + Intronic
1031929357 7:127668844-127668866 GGGGACTGCACCATGGAAATGGG - Intronic
1036798552 8:11773014-11773036 GGAGACTGAGGCTCGGAGAAGGG + Intronic
1039477084 8:37844742-37844764 GGGGACAGGGGCAAGGAGAAGGG - Exonic
1041191691 8:55361603-55361625 TAGGACTGCTCCAAGGAGAAGGG - Intronic
1042834295 8:73064154-73064176 TGGGACTGCCCCACCAAGAATGG + Intergenic
1044750242 8:95408844-95408866 GGTGACTGTGCAATGGAGAAAGG + Intergenic
1047204509 8:122792668-122792690 GGGAACTGAGGCACAGAGAAGGG + Intronic
1049058431 8:140257277-140257299 GAGGACTGAGGCACGGTGAATGG - Intronic
1050319346 9:4435221-4435243 GGGGAGTGCGAAAAGGAGAAGGG - Intergenic
1055024305 9:71703126-71703148 GGGGACTGCTCCACGGAGCCAGG + Intronic
1055982572 9:82019275-82019297 GGAGACTGAGGCAGGGAGAATGG - Intergenic
1056197074 9:84239159-84239181 GGGCACTGAGACACAGAGAAGGG - Intergenic
1058904401 9:109469970-109469992 GGGGACTGCGCCACGGAGAAGGG - Intronic
1060492652 9:124096357-124096379 GGGGACCGAGCCTCAGAGAAGGG + Intergenic
1061181511 9:129027670-129027692 GGAGACTGAGGCTCGGAGAAGGG + Intronic
1187939330 X:24365992-24366014 AGGGACTGGGCAAGGGAGAATGG - Intergenic
1188425642 X:30043754-30043776 GGGGACTGGCCAATGGAGAATGG - Intergenic
1191153196 X:57242693-57242715 AGGGACTGTGCCATGAAGAATGG + Intergenic
1192891000 X:75390281-75390303 GGGGAATTCGCCACCCAGAAGGG + Intronic