ID: 1058905258

View in Genome Browser
Species Human (GRCh38)
Location 9:109477650-109477672
Sequence GGTTAATTATTAGCAGCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058905252_1058905258 -2 Left 1058905252 9:109477629-109477651 CCTCACAGGCAGCCGTCCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1058905258 9:109477650-109477672 GGTTAATTATTAGCAGCAGCGGG No data
1058905248_1058905258 7 Left 1058905248 9:109477620-109477642 CCCTTCCAGCCTCACAGGCAGCC 0: 1
1: 0
2: 5
3: 71
4: 582
Right 1058905258 9:109477650-109477672 GGTTAATTATTAGCAGCAGCGGG No data
1058905250_1058905258 2 Left 1058905250 9:109477625-109477647 CCAGCCTCACAGGCAGCCGTCCC 0: 1
1: 0
2: 2
3: 26
4: 289
Right 1058905258 9:109477650-109477672 GGTTAATTATTAGCAGCAGCGGG No data
1058905249_1058905258 6 Left 1058905249 9:109477621-109477643 CCTTCCAGCCTCACAGGCAGCCG 0: 1
1: 0
2: 6
3: 26
4: 376
Right 1058905258 9:109477650-109477672 GGTTAATTATTAGCAGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058905258 Original CRISPR GGTTAATTATTAGCAGCAGC GGG Intronic
No off target data available for this crispr