ID: 1058905680

View in Genome Browser
Species Human (GRCh38)
Location 9:109480869-109480891
Sequence GGTGCTCAATAATTCACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058905669_1058905680 20 Left 1058905669 9:109480826-109480848 CCACTGCCGCACAGGCAGCCTGC No data
Right 1058905680 9:109480869-109480891 GGTGCTCAATAATTCACTGTGGG No data
1058905676_1058905680 -3 Left 1058905676 9:109480849-109480871 CCAGTGGCTGGTACCCAACAGGT No data
Right 1058905680 9:109480869-109480891 GGTGCTCAATAATTCACTGTGGG No data
1058905674_1058905680 -2 Left 1058905674 9:109480848-109480870 CCCAGTGGCTGGTACCCAACAGG No data
Right 1058905680 9:109480869-109480891 GGTGCTCAATAATTCACTGTGGG No data
1058905673_1058905680 2 Left 1058905673 9:109480844-109480866 CCTGCCCAGTGGCTGGTACCCAA No data
Right 1058905680 9:109480869-109480891 GGTGCTCAATAATTCACTGTGGG No data
1058905670_1058905680 14 Left 1058905670 9:109480832-109480854 CCGCACAGGCAGCCTGCCCAGTG No data
Right 1058905680 9:109480869-109480891 GGTGCTCAATAATTCACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058905680 Original CRISPR GGTGCTCAATAATTCACTGT GGG Intronic