ID: 1058906122

View in Genome Browser
Species Human (GRCh38)
Location 9:109484028-109484050
Sequence CAGAGTGAAGAGGAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 910
Summary {0: 1, 1: 0, 2: 5, 3: 85, 4: 819}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058906122_1058906125 -2 Left 1058906122 9:109484028-109484050 CCAACTTCCTCCTCTTCACTCTG 0: 1
1: 0
2: 5
3: 85
4: 819
Right 1058906125 9:109484049-109484071 TGTCGCGAGCTGCCATCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058906122 Original CRISPR CAGAGTGAAGAGGAGGAAGT TGG (reversed) Intronic
900032047 1:379284-379306 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900052596 1:607470-607492 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900480618 1:2896440-2896462 GAGAGAGAAGGGGAGGAAGAAGG + Intergenic
900488176 1:2933342-2933364 CAGGGTGATGAGGATGAAATGGG + Intergenic
901212994 1:7536935-7536957 CAGAGGGACGAGGAAGATGTGGG - Intronic
901817039 1:11800286-11800308 CAGTGGGAAGAGGAGGAGGGAGG - Exonic
902275034 1:15333343-15333365 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
902455769 1:16533039-16533061 CAGATCGGAGAGGAGGAAATGGG + Intergenic
902496401 1:16874873-16874895 CAGAATGGAGAGGGGGAAATGGG - Intronic
902986529 1:20157763-20157785 CAGAGTGAAAAGATGGAAGTTGG + Intergenic
903668706 1:25022912-25022934 CAGAGAGAAGTGGAGGAGGGAGG - Intergenic
903688753 1:25153992-25154014 CAGAGAGATGAGGTGGAAGGAGG - Intergenic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
904138011 1:28329023-28329045 AAGTGAGAAGAGGAGGAAGTTGG + Exonic
904239276 1:29133647-29133669 GAAAGAGAAGAGGAGGAAGAAGG + Intergenic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904247067 1:29195328-29195350 CCAAGTGAAGGGGAGGAAGGTGG - Intronic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
904358026 1:29954097-29954119 CAGAAAGCAGAGGAGGAAGGTGG + Intergenic
904437954 1:30511509-30511531 CAAAGTGCAGGGTAGGAAGTGGG - Intergenic
905415711 1:37802534-37802556 AAGAGGGAAGGGGAGGAAGGAGG + Intergenic
906088067 1:43152890-43152912 CAGACTGAAAACCAGGAAGTTGG + Exonic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906153821 1:43602635-43602657 CAGAGAGAAGAGTGGGAAGCAGG - Intronic
906509161 1:46401073-46401095 GGGAGGGAAGAGGGGGAAGTGGG + Intronic
906612429 1:47212613-47212635 CAGAAAGAAGAGGAAGATGTGGG - Intergenic
906661480 1:47585921-47585943 CAGCCAGAAGAGGAGGAAGAGGG + Intergenic
906662006 1:47589678-47589700 CAGGGTGAAAAGGAGGTGGTAGG + Intergenic
907123456 1:52028275-52028297 CAGAGACATGAGAAGGAAGTAGG - Intronic
907310755 1:53537736-53537758 CAGAGTGAAGAGGAGGTTTGGGG + Intronic
907971929 1:59391359-59391381 CGGAGGGAGTAGGAGGAAGTAGG + Intronic
908343101 1:63203125-63203147 AAGAGTGAAGATACGGAAGTTGG - Intergenic
908574176 1:65441665-65441687 CAGAATGACGAAGGGGAAGTGGG + Intronic
908897662 1:68918680-68918702 GAAGGTGAAGAGGAGGAAGAGGG + Intergenic
909686539 1:78355188-78355210 GAGGGAGAAGAGGAGGAAGAGGG - Intronic
909973405 1:82018212-82018234 CGGAATGAAGGGGAGGAAGGGGG - Intergenic
910149186 1:84121570-84121592 AAGTGTGAAGAAGGGGAAGTTGG + Intronic
910813675 1:91265103-91265125 CAGAGTGAATCGTAGGGAGTGGG - Intronic
912331224 1:108821843-108821865 CAGAGAGAAGAAGAAGAAGAGGG - Intronic
913186370 1:116373566-116373588 CGAGGGGAAGAGGAGGAAGTCGG + Intronic
914197065 1:145453043-145453065 CAGATGGAAGAGGAGGGAGCAGG - Intergenic
914889685 1:151612033-151612055 CGGGGTGAAGAGGAGGCAGGGGG - Intergenic
915223956 1:154397879-154397901 CAGGGAGAAGAGGAAGAAGGTGG - Intergenic
915480048 1:156178270-156178292 CAGAGGGTAGAGGAGGAAGGTGG - Intergenic
915513923 1:156401845-156401867 CAGAGGGAAGGGGAGGAGGTGGG + Intergenic
915864223 1:159481112-159481134 CAAAGTCAAAAGGAGGAAGACGG + Intergenic
915975608 1:160385541-160385563 CAGAGTGAACAGGAGTGAATGGG - Intergenic
916097368 1:161363243-161363265 CCGAGGGAAGAGGAGGAAATTGG - Exonic
916477971 1:165187588-165187610 CAAAGGGAAGTGGAGGAAATGGG + Intergenic
916742383 1:167657602-167657624 CAGAGGGGAGGGGAGGAAGGAGG - Intronic
917334196 1:173911749-173911771 CTGAGTGGAGAGGAAGAACTCGG + Intronic
917414988 1:174799696-174799718 GGGAGGGAAGAGGAGGAGGTAGG - Intronic
918048392 1:180954588-180954610 CGGAGGGATGGGGAGGAAGTGGG + Intergenic
918093505 1:181316839-181316861 AAGAGAGAAGAGGAGGCAGTGGG - Intergenic
918122124 1:181549355-181549377 CAGAGTGAGAATGAGGAAGAAGG + Intronic
918371683 1:183867533-183867555 GAGAATGAAGGGGATGAAGTGGG + Intronic
918516484 1:185369310-185369332 TAGAGGGAAGGGGAGGAAGCAGG + Intergenic
918558523 1:185835200-185835222 CAGAGTGAAGAGGAGAAGCATGG + Intronic
919822454 1:201481841-201481863 CAGAGAGAGGAGGAGGGCGTGGG + Intergenic
919936116 1:202251881-202251903 GAGAGAGAAGAGGAGGGAGAAGG + Intronic
919959782 1:202455019-202455041 CTAAGTGAAGAGAAGGGAGTGGG + Intronic
920101269 1:203518446-203518468 CAGAGTGGAGAGTGGGAGGTGGG - Intergenic
920349631 1:205329298-205329320 CAGAGGTAAGAAGAGGAGGTGGG + Intergenic
920364506 1:205440957-205440979 CAAAATGAAGAGGAAGAAGGAGG - Intronic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
921884110 1:220287286-220287308 CACAGTGAGTGGGAGGAAGTAGG - Intergenic
922034482 1:221835158-221835180 CAGTGTGAAAAGGAGGCACTTGG - Intergenic
922040247 1:221889294-221889316 CAGAGGGAAGTGGAGGAGGTAGG + Intergenic
922565323 1:226597819-226597841 CAGAGATCACAGGAGGAAGTGGG + Intronic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923760929 1:236843369-236843391 CAGAGGGGAGAGGAGGAGATTGG + Intronic
924167185 1:241296170-241296192 GAGAGGGAGGAGGAGGAAGAAGG + Intronic
924563761 1:245179146-245179168 TAGAGTGGAGAGGGGGAAATGGG - Intronic
1062782426 10:226449-226471 CATATTAAAGAGGAGGAAATAGG - Intronic
1064317694 10:14273759-14273781 AAGAGTGGAGAGGAGGACTTTGG + Intronic
1064414821 10:15139982-15140004 TAGAGAGAAGAGAAGGAACTGGG + Intronic
1064704312 10:18056167-18056189 CTGAGGGGAAAGGAGGAAGTTGG + Intergenic
1064819370 10:19308479-19308501 CAGAGTGAGGAGGATAAACTTGG + Intronic
1065390246 10:25175390-25175412 CAGAGAGAAGAGGAGGGAACGGG - Exonic
1066229584 10:33419402-33419424 GAGAGTTAGGAGGAGGAAGCTGG + Intergenic
1066562606 10:36686891-36686913 AAGAGGGAAGAGGAGGAGGAAGG + Intergenic
1067921944 10:50468007-50468029 CAGAGGGGAGAGAAGGGAGTGGG + Intronic
1069621441 10:69839983-69840005 CAGAGTGGAGAGGAGCCAATAGG + Intronic
1069783314 10:70970439-70970461 CTGAGTGGGGAGGAGGGAGTGGG + Intergenic
1070012346 10:72488725-72488747 AAGAGGGAAGAGGAGTAATTAGG - Intronic
1070277879 10:75025114-75025136 GAGATTGAAGTGGAGGAAGATGG + Exonic
1071039113 10:81285353-81285375 CAGAGTGAAAATGTGGAAATAGG - Intergenic
1071154365 10:82672323-82672345 GAGACTGGAGAGGAGGAAGGGGG + Intronic
1071239933 10:83694460-83694482 CAGACAGCAGTGGAGGAAGTGGG + Intergenic
1071494744 10:86160491-86160513 CAGAGTGGAGGGGAAGAAGGAGG + Intronic
1071563645 10:86660681-86660703 CAGAGTCAATGGGGGGAAGTGGG + Intronic
1071745874 10:88418974-88418996 AAGAGAGAACAGGAGAAAGTAGG - Intronic
1071877767 10:89861338-89861360 GAGAGGGAAGAGGAGGAGGAGGG - Intergenic
1072249814 10:93572621-93572643 CTGAGTGGGGAGGAGGAGGTGGG + Intronic
1072639587 10:97201878-97201900 GAGGGTGAAGAGGAGGGAGCAGG - Intronic
1072787718 10:98295533-98295555 CAGAGGCAGGAGGAGGGAGTTGG + Intergenic
1073243538 10:102073845-102073867 CAGAGAGATGAGGAAGAAGATGG + Intergenic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1073717689 10:106126208-106126230 CAGAGTGAAAGGGAAGAAGACGG + Intergenic
1073759831 10:106617291-106617313 CAGAGAGAGGAGGAGGCAGAAGG - Intronic
1074162806 10:110847749-110847771 CAGAGAGAAGAGGAAAAAGCGGG + Intergenic
1074417967 10:113283911-113283933 CAGACAGAAGAGGAGAAACTGGG - Intergenic
1074735146 10:116423399-116423421 CAGAGTGAGCAGGGGGAAATCGG + Intergenic
1074921528 10:118019353-118019375 AGGAGGGAAGAGGAGGAAGAGGG + Intronic
1075049821 10:119175308-119175330 CGGAGTGAAGAGCAGGCAGCAGG + Intronic
1075278010 10:121112818-121112840 CAGAGTCCAGAGGAGGGAGCAGG + Intergenic
1075518275 10:123127061-123127083 CAGAGTCAGGAGGAAGATGTGGG + Intergenic
1075726607 10:124613762-124613784 GAGTCTGAAGAGGAGGCAGTGGG - Exonic
1075744774 10:124719285-124719307 CAGAGTGCTTAGAAGGAAGTGGG - Intronic
1075851962 10:125596361-125596383 GAAAGGGAAGAGGAGGAAGAGGG + Intronic
1076169683 10:128308938-128308960 CAGTGTGCAGAGGTGGTAGTTGG + Intergenic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1077332535 11:1989779-1989801 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1078254169 11:9643101-9643123 CACAGTTCAGAGGAGGAAGTGGG + Intergenic
1079005461 11:16788746-16788768 CAGAGAGGAGAGGAGGAAGATGG - Exonic
1079088665 11:17465207-17465229 CAGAGTGGAGTGGAGGCAGGGGG - Intronic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079242162 11:18728822-18728844 CTGACTGAAGGGGAGGAAGCGGG + Exonic
1079410279 11:20181094-20181116 AAGAGGGAGGAGGAGGAAGGAGG - Intergenic
1079661396 11:23041321-23041343 TAGAATGAGGATGAGGAAGTGGG - Intergenic
1079712702 11:23707204-23707226 CAGAGAGAGGAGGAGCAAGATGG + Intergenic
1079938089 11:26642775-26642797 GAGAAAGAAGAGGAGGAAGAAGG - Intronic
1080384448 11:31802881-31802903 CAGAGTGAAGAGGAAGAAGAGGG + Intronic
1080685938 11:34514777-34514799 CAGTGGCAAAAGGAGGAAGTGGG + Intergenic
1080944632 11:36957886-36957908 TAGGGTGAAGAGGAGAAAGATGG + Intergenic
1081433928 11:43006126-43006148 AAGAAGGAAGAGGAGGAAGAAGG + Intergenic
1081675124 11:44964154-44964176 CAGAGTGGAGGGGAGGGAGGAGG - Intergenic
1081680199 11:44997128-44997150 CAGAGGGGAGAGGAGGGAGGGGG + Intergenic
1081988093 11:47321768-47321790 TAGAGGGAAGAGGAAGGAGTCGG + Intronic
1082028729 11:47590106-47590128 CAGCGTGAAGGAGAAGAAGTAGG + Exonic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082894771 11:58178453-58178475 CACAGTGAGGAGGAAGAATTTGG + Intronic
1083081291 11:60096259-60096281 CAGATTGACAAGTAGGAAGTGGG + Intronic
1083105024 11:60349006-60349028 CAGAGTGAAGAGAATGGGGTGGG + Intronic
1083133462 11:60648650-60648672 AAGACTAAAGGGGAGGAAGTTGG + Intergenic
1083237068 11:61357915-61357937 CAGGGTTAAGAGGAGTAAATGGG - Intronic
1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG + Intergenic
1083625663 11:64070842-64070864 AAGAGGGGAGAGGAGGAAGGAGG + Intronic
1083725024 11:64623416-64623438 CTGAGGGAAGAGGATGAAGAGGG - Intronic
1083912822 11:65720120-65720142 CAGGGTGAAGCGGCTGAAGTTGG + Exonic
1083949921 11:65948151-65948173 AAGAGGGAAGAGAAGGGAGTGGG + Intronic
1084565143 11:69924309-69924331 CAGAGGGAAGAGGACCAAGCTGG + Intergenic
1084718349 11:70888341-70888363 CACAGAGGAGAGGAGGCAGTTGG - Intronic
1084861077 11:72018614-72018636 CATAGGGAAGAGGAGGAATATGG + Intronic
1085026464 11:73239415-73239437 CAGCATGGAGAGGAGGAAGAGGG + Intergenic
1086054767 11:82633657-82633679 AATACTGATGAGGAGGAAGTTGG + Intergenic
1086058979 11:82681212-82681234 AAGAGTGAAGAGGGGAGAGTAGG + Intergenic
1086158624 11:83695841-83695863 CAGAGAGCACAGGAGGAATTGGG + Intronic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1087524251 11:99287991-99288013 CAAAGTGAAGAGGAGGATAAGGG - Intronic
1088205739 11:107390394-107390416 GAGAGTAAAGAGGTAGAAGTAGG - Intronic
1088740041 11:112759844-112759866 CAGAGTGATGAGAAAGAATTGGG + Intergenic
1089697670 11:120225952-120225974 CAGCGTGAAGATGAGGAGCTGGG - Intronic
1090055730 11:123422850-123422872 CAGAGTGAACACGAGGGAGAAGG - Intergenic
1090224094 11:125058578-125058600 CCAAGTGAAGAGGAGAAAGGTGG - Intergenic
1091135371 11:133184048-133184070 GACATTGAAGGGGAGGAAGTAGG + Intronic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091173708 11:133541428-133541450 CAAAGTGAAGAGCAGGAATGCGG + Intergenic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1202815516 11_KI270721v1_random:44955-44977 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1202828238 11_KI270721v1_random:100275-100297 CGGAGAGAACAGGAGAAAGTGGG + Intergenic
1091754685 12:3043741-3043763 CAGAGTGAACAGGAGAGAGGAGG + Intergenic
1091880745 12:3975508-3975530 CAGAGTGAAGTGAAGCACGTTGG - Intergenic
1091891157 12:4055605-4055627 CAGAGGGAAGGAGAGGAGGTTGG - Intergenic
1091936140 12:4435815-4435837 CAGAGGAAAGAGGAGGACTTGGG - Intronic
1092077582 12:5686163-5686185 CAGAGGGAAGTGGAGAGAGTGGG - Intronic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093092289 12:14935660-14935682 CAGGGTGAAGAGGAGGGAGTTGG - Intronic
1093508369 12:19896592-19896614 AAGAAAGAAGAGGAGGAAGGAGG - Intergenic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1094059656 12:26300261-26300283 CAGAGAGAAGAGGAAGGAGGAGG - Intergenic
1094778821 12:33765593-33765615 GAGAGTGAAGGGAAGGAAGGTGG - Intergenic
1094779256 12:33772109-33772131 GAGAGTGAAGAGGATTAATTGGG - Intergenic
1095153429 12:38823051-38823073 GAGAAGGAAGAGGAGGAAGAGGG - Intronic
1095370316 12:41459014-41459036 CAGAGTTCAAAGGAGGAATTAGG + Intronic
1095516088 12:43007113-43007135 GAGAGTGAAGATGAGGGAGGGGG - Intergenic
1095895134 12:47272496-47272518 CAGAGTGAAGCAGTAGAAGTGGG + Intergenic
1096658084 12:53104108-53104130 CACAGTCAACAGGAGGAATTGGG - Intronic
1096761690 12:53846933-53846955 GAGAGAGAAAAGGAGGCAGTTGG - Intergenic
1096862766 12:54541929-54541951 GAGGGTGAAGAGGGGGAGGTGGG - Intronic
1097207977 12:57339780-57339802 CAGAGAGAAGAGAATTAAGTAGG + Intronic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098188569 12:67924170-67924192 CAGCATGAAGAGGAGGAAATAGG + Intergenic
1098584012 12:72134784-72134806 CTGGGTGCAGAGGAGGAGGTGGG + Intronic
1098594334 12:72254575-72254597 CTGAGTGAAGATGAGGAAGAAGG - Intronic
1098607062 12:72403857-72403879 CAGAGTGGAGTGGAGGGGGTAGG + Intronic
1099010235 12:77283210-77283232 CAGAAAGAAGAGGTGGAGGTGGG + Intergenic
1099758366 12:86885702-86885724 CAGAGAGAAGAGGGGAAAGTTGG - Intergenic
1099927647 12:89037758-89037780 CAGGGTGAAGAGGTGGGAGGCGG - Intergenic
1099957946 12:89369621-89369643 CAGAGGGAAGGTGAGGGAGTGGG - Intergenic
1102230370 12:111257646-111257668 AAGAGGGAGGAGGAGGAAGGAGG - Intronic
1102244814 12:111348535-111348557 CAGGGTGAAGAGGAGCAGGGGGG - Exonic
1102391976 12:112556675-112556697 AAGAAGGAAGAGGAGGAAGTGGG + Intergenic
1102591393 12:113959226-113959248 GAGAGTGAGGAGGAGGGAGCCGG - Exonic
1102781208 12:115566383-115566405 GAGAGTGGAGAGGAGGAGGAGGG + Intergenic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104223542 12:126809731-126809753 CACATTGAACAGAAGGAAGTAGG + Intergenic
1104239601 12:126975078-126975100 CAGGGTGCAGAGCAGGAAGTAGG + Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104523263 12:129495300-129495322 CAGAGTGAGGAGGAAGACCTCGG - Intronic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1105251217 13:18699968-18699990 CAGAGTGGATAGGATAAAGTGGG - Intergenic
1105451263 13:20502335-20502357 CTGAGTGAGGAGGGGGAAGCGGG - Intronic
1105488118 13:20857790-20857812 CAGAGTTAAGTGGCAGAAGTAGG + Intronic
1105738334 13:23295715-23295737 CAGATTGGAGAGGAAGAAGGAGG - Intronic
1106214498 13:27683517-27683539 GAGAGTGAAGATGAGGACATTGG - Intergenic
1107312278 13:39092191-39092213 CAGAGTGAAGAGAAAGGATTAGG + Intergenic
1107904908 13:45052924-45052946 CAGAATGAAAAGGAGGACATAGG + Intergenic
1108000127 13:45898051-45898073 CAGTGTGATGAGGCTGAAGTAGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108909357 13:55524297-55524319 CAGAGTAAAGAGAAAGTAGTGGG - Intergenic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1109647802 13:65283001-65283023 CATATTGAAAAGGAAGAAGTGGG - Intergenic
1109932446 13:69233825-69233847 GAGAGAGAAGAAGAGAAAGTAGG - Intergenic
1110696773 13:78500175-78500197 CATAATGAAGAGGTGGAAGAGGG + Intergenic
1111231824 13:85354202-85354224 CAGAGTGCAGAGGTGTAAGTAGG - Intergenic
1111876896 13:93908943-93908965 GAGAGTGATGAGAAGGGAGTGGG - Intronic
1112311079 13:98318019-98318041 AAGAGGGAGGAGGAGGAAGAAGG - Intronic
1112403029 13:99092547-99092569 CAGAAAGAAGAGGAGGAATGGGG + Intergenic
1112492873 13:99883048-99883070 CAGAGTGAAGAAAAGGAAACAGG + Intronic
1112585051 13:100711717-100711739 GAGAGAGAGGAGGAGGAAGAGGG - Intergenic
1113285275 13:108839723-108839745 TGTAGTGAGGAGGAGGAAGTAGG - Intronic
1113394457 13:109933719-109933741 CAGGGTGAAGAGGAGGAGTGTGG - Intergenic
1114627533 14:24139177-24139199 CAGAGTGATGTGGAGGGACTGGG - Exonic
1115094538 14:29618967-29618989 GAGAATGAGGAGGAGGAAGGGGG + Intronic
1115167857 14:30469876-30469898 GTGAGAGAAGAGGAGGTAGTAGG - Intergenic
1115398307 14:32933568-32933590 CGGAAGAAAGAGGAGGAAGTGGG + Intergenic
1115892538 14:38047422-38047444 CAGAGGAAACAGGAAGAAGTTGG - Intergenic
1115960600 14:38832838-38832860 TAGAGAGAAGAGGTGGAAATTGG - Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1117325427 14:54664575-54664597 CAGGAGGAAGAGAAGGAAGTGGG - Intronic
1117460354 14:55939102-55939124 CAGAGTGGGGAGAAGGCAGTAGG + Intergenic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118980665 14:70713701-70713723 CTAAGTGGGGAGGAGGAAGTTGG - Intergenic
1119405572 14:74396574-74396596 CACAGCGAATAGGTGGAAGTTGG - Intergenic
1119430380 14:74563972-74563994 CAGGGTGGAGAACAGGAAGTGGG + Intronic
1119552667 14:75526224-75526246 CAGAGTGAAGAGAGGTAAGGTGG - Intronic
1120022556 14:79547129-79547151 TTGAGTGTAGAGGGGGAAGTGGG - Intronic
1120043813 14:79783815-79783837 AAGAATGAAGAAGAGGAATTAGG - Intronic
1120306945 14:82782845-82782867 CAGACAGAGGAGGAGGAAGAAGG - Intergenic
1120690551 14:87588093-87588115 AGGAATGATGAGGAGGAAGTAGG + Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121083070 14:91124337-91124359 CAGAGAGAAGAGGAGGCATCAGG - Intronic
1121185580 14:91964875-91964897 CAGATTGCAGAGGGGGAAGAGGG - Intergenic
1121740064 14:96245555-96245577 CAGAGTGAAGAATAAGAATTGGG - Intronic
1122036784 14:98954712-98954734 CACAGTGAAGAGCAGTTAGTCGG + Intergenic
1202852335 14_GL000225v1_random:29751-29773 CGGAGTGACGAAGAGGAAGGGGG - Intergenic
1202853412 14_GL000225v1_random:36044-36066 CAGAGAGACGAAGAGGAAGGGGG - Intergenic
1202854517 14_GL000225v1_random:42486-42508 CAGAGAGACGAAGAGGAAGGGGG - Intergenic
1202855962 14_GL000225v1_random:52511-52533 CAGAGAGACGAAGAGGAAGGGGG - Intergenic
1202865677 14_GL000225v1_random:115293-115315 CAGAGAGACGAAGAGGAAGGGGG + Intergenic
1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG + Intergenic
1202924124 14_KI270724v1_random:8454-8476 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
1123827219 15:24094106-24094128 GAGAATGAAGAGGAGAAAGAAGG + Intergenic
1124354572 15:28985162-28985184 CTGGGAGAAGAGGAGGAGGTGGG + Intronic
1124801451 15:32837039-32837061 CAGAGTGAGAAGGATGAAGATGG - Intronic
1124872731 15:33559084-33559106 CAGAGGGTAAAGGAGGAGGTTGG + Intronic
1125023829 15:35010780-35010802 CAGGCTGAAGAGGTAGAAGTTGG + Intergenic
1125524715 15:40367725-40367747 CAGATTGACGAAGGGGAAGTAGG - Exonic
1125889313 15:43253843-43253865 CGGAGTGAAGGGGAGGGATTTGG - Intronic
1126416063 15:48418590-48418612 CAGAGTGCAGAGGATGAAAAAGG - Intronic
1127106490 15:55622121-55622143 CAGAGTGGGGAGGATGATGTAGG - Intronic
1127246690 15:57184326-57184348 CAGAGCTTAGAGGAGAAAGTGGG - Intronic
1127280812 15:57490716-57490738 CAGAGTGTACAGGATGAAGTGGG + Intronic
1127569730 15:60230188-60230210 GGGAGTGGAGATGAGGAAGTGGG + Intergenic
1127819199 15:62640370-62640392 CAGAGAGAAGAGGGGGACGGTGG + Intronic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1128154285 15:65383073-65383095 CTGAGTGAAGAGGAGGCAGGAGG + Exonic
1128342303 15:66830982-66831004 CTGGGTGAAGAGGAGGAATCAGG + Intergenic
1128349271 15:66878180-66878202 CAGAGAGAAGAGGAGAAGGAGGG + Intergenic
1128698985 15:69790154-69790176 CTGAGGGAAAAGGAGGATGTGGG - Intergenic
1129131400 15:73500812-73500834 CAGAGTTCAGAGGAGGGAGTGGG - Intronic
1129411797 15:75354508-75354530 CAGAGTGCAGGGGAGGAGGCGGG - Intronic
1130224007 15:82044622-82044644 CAGGGTGCGGAGGAGGGAGTGGG + Intronic
1130717223 15:86346728-86346750 CACATTGAAGAGGAGGAATCAGG + Intronic
1130871958 15:87978663-87978685 CAGAGAGAAGAGGAAGTAGGGGG + Intronic
1130993203 15:88889047-88889069 GAGAGGGAAGAGGAGGAAGACGG + Intronic
1131373473 15:91903963-91903985 GAGAGTGAAGAGGAGGAAACAGG + Intronic
1132358337 15:101190226-101190248 CTGAGGGAAGAAGAGGGAGTGGG + Intronic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1133003804 16:2866221-2866243 CAGAGAGAAGGGGAGGAGCTGGG - Intergenic
1133361202 16:5175191-5175213 CAGCTTGAAGATGAGCAAGTGGG - Intergenic
1133433136 16:5755922-5755944 CATAATGAAGAGAGGGAAGTAGG + Intergenic
1133598275 16:7313850-7313872 CACAGTGAGGAGGAGGACATAGG - Intronic
1134011023 16:10853216-10853238 CAGAGTGAATAGAATGAAGTAGG + Intergenic
1134131293 16:11651983-11652005 CAGGGGGCAGATGAGGAAGTGGG + Intergenic
1134316782 16:13126408-13126430 CAGAGAGAGGAAGAGGAAGAGGG + Intronic
1134449395 16:14354215-14354237 TAGAGGGAGGAGGAGGAAGGGGG + Intergenic
1135166792 16:20146271-20146293 CAGAGACAAGAGCAGGAAATGGG - Intergenic
1135228962 16:20687055-20687077 CTGAGAGAAGAGGTGGGAGTTGG - Intronic
1135716611 16:24775524-24775546 GAGAGTGTGGAAGAGGAAGTTGG + Intronic
1135865841 16:26101098-26101120 AAAAGTGAAGAGGAGCAAGAAGG - Intronic
1135870594 16:26146366-26146388 CTGAGTGAAGAGGAGGATACAGG - Intergenic
1135925838 16:26693428-26693450 CAGAGAGAGGCGGACGAAGTTGG - Intergenic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136343815 16:29662926-29662948 AAGGGTGCAGAGGAGGAGGTGGG - Intergenic
1137706498 16:50539294-50539316 CAGGGGGAGGAGGAGAAAGTGGG - Intergenic
1138248952 16:55487862-55487884 AAGAATGAAGAGGAGGAGGGAGG - Intronic
1138939963 16:61778190-61778212 CAGGGTGAAGGGGAGATAGTGGG - Intronic
1139177533 16:64707616-64707638 AAAAGTGAAGAGGAAGAAGAAGG - Intergenic
1139615838 16:68090714-68090736 CAGTATGAAAAGGAGGAAGTTGG + Intronic
1139872411 16:70118189-70118211 AAGAGAAGAGAGGAGGAAGTGGG + Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139946315 16:70644851-70644873 GAGGAGGAAGAGGAGGAAGTAGG + Intronic
1139946366 16:70645075-70645097 AAGAGGGAAGAGTAGGAAGGAGG + Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140363360 16:74363106-74363128 AAGAGAAGAGAGGAGGAAGTGGG - Intergenic
1140852540 16:78948568-78948590 CAGAGGGATGAGGAGGCAGCAGG - Intronic
1141188543 16:81806883-81806905 CAGAGTTATGGGGAGGAAGCAGG + Intronic
1142259324 16:89035235-89035257 GAGAATGAAGAGGAGGGAGGGGG - Intergenic
1142503677 17:349127-349149 CAGAGGGAAAAGGAGGGACTTGG + Intronic
1143090534 17:4446969-4446991 CAGAGGGAAGAAAAGGAAGCTGG - Intronic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143363209 17:6388056-6388078 CAGAGTGAGAAGGGGGATGTGGG + Intergenic
1143787404 17:9266220-9266242 GAGATTGGAGAGGAAGAAGTTGG + Intronic
1145798608 17:27669772-27669794 CAGGGCCAAGAGGAGGAAGCAGG + Intergenic
1146058313 17:29591943-29591965 CAGGGTGTGGAGGAGGAAGGAGG + Intronic
1146552963 17:33797974-33797996 CAGTGTGCAAAGGAGGAAGTGGG + Intronic
1146811193 17:35904966-35904988 CAGAGGAAAGAGAATGAAGTGGG - Intergenic
1146827124 17:36032555-36032577 CAGGCTGGAGAGGAGGGAGTTGG - Intergenic
1147510404 17:41064204-41064226 AAGAGTGAAGAGGAAGATGATGG - Intergenic
1147769376 17:42857027-42857049 CAGGAGGAGGAGGAGGAAGTAGG - Exonic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149154809 17:53615030-53615052 CAGGGTGGAAAGGAGGGAGTGGG + Intergenic
1149157343 17:53647727-53647749 CAGAGTGTAGAGCACCAAGTGGG - Intergenic
1149354865 17:55829066-55829088 GAGAGAGAAGAGGAGACAGTGGG + Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1151384022 17:73744256-73744278 CAGAGTGAAAGGCAGGAAGAGGG - Intergenic
1151388974 17:73772844-73772866 GAGAGTGCAGTGGAGGCAGTGGG - Intergenic
1151439855 17:74121186-74121208 CAGAGCGCAGAAGAGGGAGTAGG + Intergenic
1151888738 17:76939665-76939687 CAGAGTGGGGAGGAGGAAGGGGG - Intronic
1152598381 17:81249277-81249299 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152598386 17:81249294-81249316 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152598391 17:81249311-81249333 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152598396 17:81249328-81249350 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152947607 17:83206430-83206452 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1153045037 18:848193-848215 CAGAGTGGAGAGGAAGTAGAAGG - Intergenic
1153185250 18:2478905-2478927 AAGAGGGAGGAGGAGGAAGAAGG + Intergenic
1153460916 18:5332305-5332327 CAGAGTGAAGATGAAGACGGAGG + Intergenic
1153782593 18:8507195-8507217 CAGGGGGAAGAGGAGGGTGTTGG + Intergenic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1153985003 18:10343846-10343868 CAGAGTGCCCAGGAGGAAGCTGG - Intergenic
1154047861 18:10924112-10924134 CAGAGTGGAGAGCAGGAATTGGG - Intronic
1154437717 18:14359988-14360010 CAGAGTGGATAGGATAAAGTCGG + Intergenic
1154937922 18:21079557-21079579 AAGAGTGAAGAGGGGAGAGTAGG + Intronic
1155517383 18:26637211-26637233 TAGAGTCAGGAGGAGGAAGGAGG - Intronic
1156133112 18:34002591-34002613 CAGAGTGAAGAAGATGGAGGTGG - Intronic
1156598848 18:38579837-38579859 TAGAAGGAAGAGGAAGAAGTAGG + Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1157689340 18:49668401-49668423 CACAGTGACCAGGAGGAACTTGG - Intergenic
1157729055 18:49988158-49988180 TTGGGTGAAGAGGAGGAAGAAGG + Intronic
1157966434 18:52213423-52213445 CAGATAGAAGATGAGGGAGTGGG + Intergenic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1158535396 18:58303965-58303987 CAGAGTGGAGGGGAGGGAGTAGG + Intronic
1158610508 18:58935491-58935513 GAGAGGGAGGAGGAGGAAGGGGG - Intronic
1158622178 18:59042403-59042425 CAGTGCTAAGAGGAGGAAGCAGG - Intergenic
1158671360 18:59476897-59476919 CAGAATCAAGGGGTGGAAGTGGG + Intronic
1159334852 18:67048733-67048755 CTGAGCTAAGAGGAGGGAGTTGG - Intergenic
1159520724 18:69518283-69518305 GAGAAGGAAGAGGAGGAAGAAGG - Intronic
1159693288 18:71519726-71519748 CAGACAGGAGAGGATGAAGTGGG - Intergenic
1159796092 18:72846153-72846175 CAGAGCCAAGAGGAGCAAGCAGG + Intronic
1160225871 18:77010031-77010053 CAGAGTGAGGAGGAGTGAGCGGG + Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161030670 19:2056461-2056483 CAGAGTGAAGAGGAGGGCCTGGG + Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1162000161 19:7739433-7739455 AAGAATGAAGAGGAGCAGGTAGG + Intergenic
1162044690 19:7990801-7990823 TAGAGGGAAGAGGAGGAAGAGGG + Intronic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1162909952 19:13843145-13843167 CAGGGTCCAGAGGGGGAAGTTGG - Intergenic
1162917512 19:13882268-13882290 GAGGGCGAGGAGGAGGAAGTGGG + Intergenic
1163252234 19:16132810-16132832 CTGAGAGAAGAGGTGGAAGTGGG - Exonic
1163302785 19:16458190-16458212 CACAGCGATGAGGAGGAAGGTGG - Intronic
1163811177 19:19432767-19432789 CAGAGTGAGCAGGCTGAAGTGGG + Intronic
1163864289 19:19759502-19759524 AAGAGAGAAGAGGAGGAAACAGG - Intergenic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1164567662 19:29339479-29339501 GAGAAGGAAGAGGAGGAAGAAGG + Intergenic
1164773805 19:30834739-30834761 CAGAGTGAGGGGCAGGAACTGGG - Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1164868676 19:31625758-31625780 GAGAGGGAAGAGGAGGAGGAGGG - Intergenic
1164919955 19:32082056-32082078 CAGCATGAAGAGAAGGGAGTGGG + Intergenic
1166293350 19:41877345-41877367 CAGCAGGAAGAGGAGGAAGATGG - Exonic
1166366088 19:42279265-42279287 CAGAGGGATGAGGAGGGAGCTGG - Intronic
1166748112 19:45151577-45151599 CATGGTGCAGAGGAGTAAGTGGG + Exonic
1166882844 19:45939805-45939827 GAGAGGGAAGAGGAGGAGATGGG + Exonic
1167191248 19:47991609-47991631 AGGAGGGAAGAGGAGGAAGAGGG - Intronic
1167304135 19:48697017-48697039 CAGAGGGGAGAGGAGGAAGCCGG + Intronic
1167429023 19:49443639-49443661 GATGGTGAAGAGGAGGGAGTGGG + Intergenic
1167608146 19:50492729-50492751 AAGAGGAAAGAGGAGGAAGGGGG + Intergenic
1167924982 19:52813883-52813905 TGGAGGGAATAGGAGGAAGTGGG + Intronic
1168078590 19:53993350-53993372 CTGAGAGCAGAGGACGAAGTGGG - Intronic
1168527450 19:57100219-57100241 CAGAGGGAGGAGGAGTGAGTGGG + Intergenic
1202706663 1_KI270713v1_random:29396-29418 CAGAATGGAGAGGGGGAAATGGG + Intergenic
925280762 2:2682994-2683016 CAGGGAGAAGCAGAGGAAGTAGG + Intergenic
925383747 2:3447464-3447486 GAGAGAGAAGAGGAGGAGGAGGG + Intronic
925738689 2:6986288-6986310 CAGAGTAGGGAGGAGGAAATCGG - Intronic
927061509 2:19427161-19427183 CAGAGAGAAGAAAAGGAGGTAGG + Intergenic
927404034 2:22747513-22747535 CAGAGTGATGAAGAGGAACAGGG + Intergenic
928172864 2:29014571-29014593 GAGCGGGAGGAGGAGGAAGTGGG + Intronic
928269297 2:29841990-29842012 AGGAGTGAAGAGGAGGATGGAGG - Intronic
928361303 2:30664275-30664297 GAGAGTGAAGAAGAGGGAGAAGG + Intergenic
928413154 2:31069961-31069983 CCGAGAGAAGAGGAGGAGGATGG + Intronic
928705322 2:33943620-33943642 AAGAGAGAAAAGAAGGAAGTGGG + Intergenic
929222893 2:39483733-39483755 CAGAGAGAAGAGGAAGAGGAAGG - Intergenic
929251447 2:39760255-39760277 GACAGGGAAGAGGGGGAAGTTGG + Intronic
929607115 2:43242019-43242041 CTAAGTGAAAAGGAGGAAGAAGG - Intronic
929747840 2:44677433-44677455 CAGACTGCTGATGAGGAAGTTGG - Intronic
930050163 2:47209133-47209155 AAAGGTGAAGAGGCGGAAGTGGG - Intergenic
930261988 2:49157690-49157712 GAGAGAGAAGAAAAGGAAGTTGG - Intergenic
930380204 2:50618146-50618168 CACAGTGAAAATGAGGAAGTTGG + Intronic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931347026 2:61455990-61456012 CAGAGTACAGATGAGGCAGTAGG - Intronic
931777282 2:65551584-65551606 TTGACTGAAGAGGTGGAAGTAGG - Intergenic
931883129 2:66587777-66587799 CCGAGTAAAGAGGAAGATGTGGG + Intergenic
932218051 2:69979456-69979478 CAGAGAGGGGAGGAGGAACTGGG + Intergenic
932502701 2:72197979-72198001 CAGAGCAAAGAGGAGAATGTTGG + Intronic
932907312 2:75767867-75767889 TACAGTGATGAGGAGTAAGTGGG + Intergenic
933003984 2:76966314-76966336 CAGGGAGCAAAGGAGGAAGTGGG + Intronic
933060487 2:77730988-77731010 CAGTGTGAGGATGTGGAAGTGGG - Intergenic
933160190 2:79015324-79015346 CAGAGTGGAGGAGAGGAAGATGG - Intergenic
933271850 2:80241092-80241114 CAGATTGAATAGGACAAAGTGGG - Intronic
933861968 2:86478485-86478507 CAGGATGAAAAGGAGGGAGTGGG + Intronic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935687888 2:105700394-105700416 CAGATATAAGAGGAGGAAGATGG - Intergenic
936284717 2:111173245-111173267 CAGAGTGAGGATGGGGCAGTGGG - Intergenic
937053404 2:118910623-118910645 GAGAGGGAAGGGGAGGAAGAGGG + Intergenic
937096119 2:119236318-119236340 CATAGTGCAGATGAGGAAATGGG + Intronic
937322671 2:120970364-120970386 CAGAGAGCAGACAAGGAAGTGGG - Intronic
937463131 2:122106452-122106474 CTGAGTGTAGAGGTGGAGGTGGG + Intergenic
937822459 2:126326287-126326309 CAGAATGAAGAGGAGGTAATGGG - Intergenic
937985949 2:127638181-127638203 CAGTGGGCAGAGGAGGAGGTGGG - Intergenic
938114163 2:128592069-128592091 CAGAGTGCAGTGGAGGAGGCTGG + Intergenic
938183410 2:129206018-129206040 GAGAGGGAAGGGGAGGAAGGAGG + Intergenic
938187552 2:129245210-129245232 CAGAGAGATGAGCAGGAAGAGGG - Intergenic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
938730278 2:134141957-134141979 CAGTGTGAAAAGGAGGGAATAGG + Intronic
939360578 2:141166666-141166688 TAGAGTGGGGAGGGGGAAGTGGG - Intronic
939554687 2:143660235-143660257 CAGAATGTGGAGGAGGAAGGAGG - Intronic
940770560 2:157835197-157835219 CACAGTGTAGGGGAGGAAGGGGG - Intronic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
942201725 2:173578040-173578062 CAGAGTGAAGAGGATGTGTTGGG - Intergenic
942572042 2:177324509-177324531 CAAAATGAAGAGGAGGGGGTGGG - Intronic
942863484 2:180644389-180644411 CAGAGGGTAGTGGAGGGAGTAGG + Intergenic
943887233 2:193234733-193234755 GATAGGGAAGAGGAGGAAATAGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
943977925 2:194507838-194507860 CAGAGGAAAGAGTGGGAAGTGGG + Intergenic
944086288 2:195851232-195851254 AAGAGTGAAGATGACAAAGTGGG + Intronic
944109837 2:196120629-196120651 GAGAGTGAAGAAGATGAAGGTGG - Intergenic
944282057 2:197909518-197909540 CAGAGCCATGAGGAGGAAGTGGG - Intronic
945469173 2:210207393-210207415 CTGACTGAAGAAGAGGAAATTGG - Intronic
945571326 2:211471587-211471609 CACAGTTAAGAGGTGGAACTGGG + Intronic
945613558 2:212037219-212037241 CAAAGTGTAGAAGGGGAAGTTGG + Intronic
946181312 2:217950783-217950805 AAGAGTGCAGAGGAGGAAGAGGG - Intronic
946242910 2:218367786-218367808 CAGCAGGAAGAGCAGGAAGTCGG - Exonic
946549910 2:220789949-220789971 CAGAGTGAAGAGAAGAATTTTGG - Intergenic
946724108 2:222644378-222644400 GAGAATGAAGAGGAGGAGGAAGG + Intronic
946992227 2:225346802-225346824 AAAAGAGAAGAGGAGGAAGAGGG - Intergenic
948044859 2:234935797-234935819 CAGAGTCTAGAGGTGGCAGTGGG - Intergenic
948233220 2:236366798-236366820 GAGAGAGAGGAGGAGGAAGGAGG - Intronic
948602021 2:239112635-239112657 CAGAGTGGAGTGGAGGGAGCAGG + Intronic
948807156 2:240457947-240457969 CACAGTGGAGAGGTGGAAGCAGG - Intronic
948814015 2:240500489-240500511 CAGGGAGAAAAGGAGGCAGTGGG - Exonic
949073063 2:242038448-242038470 CTGAGAGAAGAGGATGGAGTGGG + Intergenic
1168826898 20:820014-820036 CAGAGGGAAGAGGAAGGAGAAGG - Intergenic
1168994030 20:2119257-2119279 CAGAGTCAAGAGGAGGGAATTGG + Intronic
1169089316 20:2848462-2848484 TAGATTCAAGAGGTGGAAGTGGG - Intronic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169975129 20:11316674-11316696 CATGGAGAAGAGGAGGAAGTTGG + Intergenic
1170686736 20:18576155-18576177 CTGAGTGAAGTGCAGGAAGTTGG + Intronic
1170815326 20:19709020-19709042 GAGAGTGGAGAGGAAGAAGGAGG + Intronic
1171160179 20:22915058-22915080 CAGAATGAAGTGGATGAATTGGG + Intergenic
1171471960 20:25379344-25379366 CAGAGGGAAAAGGAGGTACTGGG - Intronic
1171947231 20:31389487-31389509 CAAAGTAAGGAGTAGGAAGTTGG - Intronic
1172785467 20:37465469-37465491 AGGAGAGAAGAGGAGGAAGGAGG - Intergenic
1172823437 20:37759195-37759217 CAGAAAGAAGAGGATGATGTTGG + Intronic
1173006453 20:39143107-39143129 CGGGGAGAAGAGGAGGGAGTGGG - Intergenic
1173185422 20:40836590-40836612 CAGAGTGTAGAGGAGGATAAAGG - Intergenic
1173317117 20:41955022-41955044 CAGGCTGAAGGGGAGGAAGAAGG - Intergenic
1173575025 20:44107352-44107374 CAGGGAGAAGAGAAGGATGTGGG - Intergenic
1173613429 20:44387590-44387612 CTGAGTGAAGAGTAGGGGGTAGG + Intronic
1173729194 20:45316931-45316953 CTGGATGAAGAGGTGGAAGTTGG - Exonic
1173821357 20:46022252-46022274 CAGAGTGAGGAGGTGGAACTAGG + Intronic
1173857164 20:46257892-46257914 CAGAGAGAAGGGGAGGAAAAGGG + Intronic
1174079044 20:47957952-47957974 CAGATGGGAGAGGAGGAAGGAGG + Intergenic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174766314 20:53257132-53257154 CAAAGGGAAGAGGTGGAAGGTGG - Intronic
1174961950 20:55167578-55167600 CAGAGAGAGGAGGAGGAGATAGG + Intergenic
1174984913 20:55440281-55440303 TAGGGTGAAGAGGAGGAACTGGG + Intergenic
1175461628 20:59155952-59155974 AAGACTAAAGAGGAAGAAGTAGG + Intergenic
1175625585 20:60486095-60486117 GAGAGTCCAGAGGAGGCAGTGGG + Intergenic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1175723385 20:61300855-61300877 AAGGGTGAGGAGGAGGAGGTGGG - Intronic
1175840042 20:62020931-62020953 CAGCGTGAACATGAGGAAGGAGG + Intronic
1175853834 20:62108313-62108335 CATATTGAAAAGGAAGAAGTAGG + Intergenic
1175914584 20:62419727-62419749 CATCCTGAAGAGGAGGAAGAGGG + Exonic
1176661927 21:9644908-9644930 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1176836739 21:13799852-13799874 CAGAGTGGATAGGATAAAGTGGG - Intergenic
1176956064 21:15105387-15105409 AAGAGGGAAGAGGAAGAAGAGGG - Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1178501420 21:33128726-33128748 CAGCTGGAAGAAGAGGAAGTGGG - Intergenic
1179236741 21:39554167-39554189 CAGAATGACTAGGAGGAAGGAGG - Intergenic
1180070879 21:45435316-45435338 CGGAGGGAGGAGGAGGAAGTGGG + Intronic
1180202049 21:46229760-46229782 CAGAGGGAAGAGGAAGATGGAGG + Intergenic
1180708136 22:17822175-17822197 CAGAGGGAAGGGGCAGAAGTGGG + Intronic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181426960 22:22849977-22849999 CAGACTGAGGAAGAAGAAGTGGG - Intronic
1181661447 22:24352767-24352789 CACAGGGAAGAGGAAGAAGAAGG - Intronic
1181772792 22:25138953-25138975 CAGAGGGAAGACCAGGAAGGGGG - Intronic
1181824852 22:25506867-25506889 CAGAATGAAGAGCCGGATGTAGG - Intergenic
1181887209 22:26030797-26030819 CCAAGTGAAGAGGAGGAGGAAGG - Exonic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182134828 22:27891671-27891693 GAGAGAGAGGAGGAGGAAGGAGG - Intronic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
1182432882 22:30310950-30310972 CAGGATGGAGAGGAGGCAGTTGG + Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183068521 22:35380341-35380363 CAGAGTGTGGAGGAGGCAGGCGG + Intronic
1183270431 22:36859113-36859135 CTGAGGGAAGAGGAGGACATTGG - Intergenic
1184049630 22:41994823-41994845 CAGAGTTGAGAGGAAGAAGGTGG - Intronic
1184160025 22:42692485-42692507 CAGAGAGGAGAGGAGGCTGTTGG - Exonic
1184467324 22:44676611-44676633 CGGGGTGAAGAGGAGGAGGGGGG + Intronic
1184670437 22:46009606-46009628 CAGAGAGGAAAGGAGGAAATTGG + Intergenic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
949680708 3:6511372-6511394 GAGAGTAAAGAAAAGGAAGTAGG + Intergenic
950164036 3:10780222-10780244 CATAGTGAGGCCGAGGAAGTGGG - Intergenic
950899629 3:16486085-16486107 CAGAAAGCAGAGGAGGAGGTGGG - Intronic
952319415 3:32262069-32262091 CAGAAGGAAGACGAGGAAGCAGG + Intronic
952500758 3:33959659-33959681 GAGAGGGAGGAGGAGGAAGCAGG + Intergenic
952553847 3:34509479-34509501 GAGAAGGAGGAGGAGGAAGTGGG - Intergenic
952737395 3:36704304-36704326 CAGAGTGATGGGCAGAAAGTAGG + Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
953919308 3:46941010-46941032 CTCAGAGAAGAGGAGGAAGAAGG - Exonic
953938256 3:47066070-47066092 CAGACTGACGAGGAAGAAGAGGG - Intronic
954747408 3:52794975-52794997 TGGAGTGAAGAGGAGGCAGAGGG + Intronic
955567023 3:60258381-60258403 CATTTTGAAGAAGAGGAAGTGGG - Intronic
955911132 3:63861552-63861574 AATAGTGAAGAGCAGGAACTCGG + Intronic
956547785 3:70425013-70425035 GAGAAGGAAGAGGAGGAAGAAGG + Intergenic
957080746 3:75633837-75633859 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
957652921 3:83032539-83032561 AAGAGGGAAGAGGAGGGAGAAGG - Intergenic
957834844 3:85574047-85574069 TAAAGTGATGAGGAGGAAGGAGG - Intronic
957969843 3:87368672-87368694 CAGAGTAAAGAGGAGGCACTAGG + Intergenic
959107291 3:102079121-102079143 ATGAGTGGAGAGGAGGAAGCTGG - Intergenic
959600245 3:108174339-108174361 CAAAATGAAGAAGAAGAAGTGGG + Intronic
959814151 3:110655552-110655574 CACGGGGAAGAGGAGGGAGTTGG + Intergenic
960874529 3:122283906-122283928 CAGGGAGAAGAGGAGGAGGTAGG - Exonic
960985721 3:123279349-123279371 GAGAGGGAAGGGGAGGAAGACGG - Intergenic
961445205 3:126977303-126977325 CAGAGTGAGTAGGTGGAACTGGG - Intergenic
961522733 3:127476653-127476675 GGGAGAGAAGAGGAGGAAGGTGG + Intergenic
961523784 3:127483817-127483839 CTGAGTCAAGAGGAGGGAGGAGG + Intergenic
961741012 3:129033127-129033149 CAGCATGTAGAGGATGAAGTGGG + Intronic
962876997 3:139542731-139542753 CAGAGAGATGAGGAGGAGGAAGG + Intergenic
963039011 3:141055232-141055254 CGGAGGGAAGAGGATGTAGTGGG + Intronic
963049137 3:141126974-141126996 GGGAGTGAAGAGGTGGAAGAAGG - Intronic
963748956 3:149154868-149154890 CAGAGTGAATTGGAAGCAGTTGG + Intronic
963817257 3:149845398-149845420 CATAGTGAACAGGATGAAGTTGG + Intronic
964659911 3:159108898-159108920 CAGATGGTAGAGGAGGGAGTGGG + Intronic
964820003 3:160757815-160757837 CAGAGGGCAGAGAAGAAAGTTGG - Intronic
965279749 3:166734680-166734702 CAGAGACAAAAGGTGGAAGTGGG + Intergenic
966450161 3:180050034-180050056 GAGGGTGAAGAGGGGGAAGGAGG - Intergenic
968725180 4:2243788-2243810 CAGTTTGGACAGGAGGAAGTGGG + Intergenic
969193886 4:5545505-5545527 CAGAGTTATCAGGAGGAAGCAGG + Intronic
969239798 4:5890676-5890698 CAGGGAGAAGAGGAAGGAGTAGG + Intronic
969322871 4:6423708-6423730 CAGGGTGAGGAGGAGTCAGTGGG + Intronic
969858651 4:10019205-10019227 CAGAGAGAAGAGACGCAAGTTGG + Intronic
969887330 4:10226766-10226788 CGTGGTGAAGAGGAGCAAGTAGG - Intergenic
969962091 4:10955003-10955025 CACAGAGGAGAGGGGGAAGTGGG + Intergenic
970166394 4:13242745-13242767 CAGGGTTAGGAGGAGGATGTAGG - Intergenic
972431630 4:38988546-38988568 GAGAGAGAAGAACAGGAAGTGGG - Intronic
972685388 4:41347822-41347844 CAGAGTGAAGAAGAGAAGGAAGG - Intergenic
973222507 4:47744928-47744950 CAGATTGCAAAGGAAGAAGTAGG + Intronic
973611222 4:52637544-52637566 GAGAGTGCAGAGGACGATGTCGG - Intronic
975113424 4:70651820-70651842 CAAAGTGAAGAGGAAAATGTAGG - Intronic
975116796 4:70688879-70688901 CAGAGTGGAGACGAGGAGGATGG + Exonic
975483249 4:74905393-74905415 CAGAAGGAAGAGGAGGAATGGGG + Intergenic
975546735 4:75568087-75568109 CCATGTGAAGAGGAGGAAGAGGG - Intergenic
975878426 4:78871463-78871485 CAGAGTGGAGGGTAGTAAGTAGG + Intronic
976222590 4:82769791-82769813 CAGAGTGAGAGGGAGGAAGGGGG + Intronic
976276660 4:83285136-83285158 AAGAGTCGAGCGGAGGAAGTTGG + Intergenic
976428716 4:84937360-84937382 CAGGGAGAAGAGGAGGAACTAGG - Intronic
976826686 4:89268398-89268420 CAGAGTGATTAGGAGAATGTTGG + Intronic
977080587 4:92522518-92522540 CAAAGTGCAAAGGTGGAAGTAGG + Intronic
977766611 4:100806028-100806050 GAGACAGAAGGGGAGGAAGTGGG + Intronic
978291995 4:107152554-107152576 CAGTGTGAAGAAGGGGAAGTTGG + Intronic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
978820068 4:112956837-112956859 CTGAATGAAGAGAATGAAGTGGG + Intronic
979343526 4:119557270-119557292 CAGAGTTAAGGAGAGGAAGAAGG - Intronic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
979782742 4:124674677-124674699 GGGAATGAAGAGGAGGGAGTAGG + Intronic
980654741 4:135767086-135767108 CAGAGTGAAGAGCAGGCCTTGGG + Intergenic
980726579 4:136769633-136769655 GAGGGTGAAGAGAAGGAAGTGGG - Intergenic
980979670 4:139643473-139643495 CAGGGTGCTGAGGAGGAAGAAGG - Intergenic
982058477 4:151577922-151577944 AAGGGAGAAGATGAGGAAGTTGG - Exonic
983366484 4:166797066-166797088 CAGATTGAAGAGGAGTAAGGAGG + Intronic
983412322 4:167417042-167417064 AAGAGTGAAGAGGGGAGAGTAGG - Intergenic
983595856 4:169467003-169467025 TAGGCTGAAGAGGAGGAAGTTGG - Intronic
984140909 4:176002523-176002545 CACAGTGAAGGGGAGGAAAACGG - Intronic
984658406 4:182345411-182345433 CAGATTTAAGAGGTAGAAGTAGG + Intronic
984858861 4:184219286-184219308 CAGAGGGCAGAGGTGGAAGAGGG - Intronic
984868762 4:184308999-184309021 GAGGCTGAAGAGGAGGAAGAGGG + Intergenic
985413468 4:189711638-189711660 AGGAGTGAAGAGCAGGAAGGTGG - Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
985824791 5:2184153-2184175 GACAGTGAAGGGGAGGAAGCGGG - Intergenic
985978072 5:3437916-3437938 CAGAGGGAAGATGATGATGTTGG + Intergenic
985987580 5:3529585-3529607 TAGAGGCAAGAGGAGGAAATGGG + Intergenic
986171803 5:5320451-5320473 CTGAGTGAAGAGGAGGCTGCAGG + Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986599670 5:9459226-9459248 GAGTGTGAACAGGAGGAAGCAGG - Intronic
986701341 5:10412479-10412501 GAGAGTGAAAAAAAGGAAGTGGG + Intronic
987605815 5:20134744-20134766 CAAAGTCAAAAGGAGGAAGGAGG - Intronic
987927818 5:24364776-24364798 CAGAGAGAAAATGAGGAGGTAGG + Intergenic
988153133 5:27413633-27413655 TAGAGTGAAGAGGAGGAGCAAGG - Intergenic
988404622 5:30808223-30808245 AAAAGAGAAGAGAAGGAAGTAGG + Intergenic
988873539 5:35417977-35417999 CAGAGGGAAGAGGAGGAGAATGG - Intergenic
990165832 5:52992293-52992315 CAGAATGAAGAGGAGGATTCAGG - Intronic
990370543 5:55114161-55114183 CTGAGTGAAGATGATGATGTTGG - Exonic
990747465 5:58974725-58974747 CAGGTTGAAGAGGAGGCAGTAGG - Exonic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
992761863 5:79957555-79957577 CACAGTGGAAAGGAGGAAGTAGG + Intergenic
993245045 5:85440239-85440261 CATAGTGGAGAAGAGCAAGTGGG + Intergenic
993317010 5:86422436-86422458 CAGAGTAAAGTGGAAGAAATTGG - Intergenic
993454563 5:88112767-88112789 CACAGTGAGGAGGATGAAATAGG + Intergenic
993565585 5:89470891-89470913 CATAGTGAACCGGGGGAAGTGGG + Intergenic
993735982 5:91477273-91477295 CAGTAGGAAGAGGAGGAAGTGGG - Intergenic
993923027 5:93830773-93830795 CAGAGTGGAGAGGATGATTTTGG + Intronic
993967426 5:94374815-94374837 AAGGATTAAGAGGAGGAAGTAGG - Intronic
994784043 5:104132832-104132854 CATGCTGAAGAGGAGGAAGCTGG - Intergenic
995069677 5:107904961-107904983 CAGAGGGAAGAGGAGGGAAGAGG + Intronic
995301785 5:110593680-110593702 TAGGGTGATGAGGAGGAAATAGG + Intronic
995566955 5:113440755-113440777 AAGAAAGAAGAGGAGGAAGAAGG + Intronic
995683453 5:114745590-114745612 CAGAGTGAAGAGTTGAAATTCGG + Intergenic
996040032 5:118799031-118799053 CAGAGTCAAGATGAAGAAGTGGG + Intergenic
996060839 5:119031625-119031647 AAGAATGAACAGGAGGATGTGGG - Intergenic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996199893 5:120658939-120658961 CAGAGGGAAGAATAAGAAGTTGG - Intronic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
997528398 5:134567834-134567856 CAGAAGGAAGAGGTGGAGGTGGG + Intronic
998413214 5:141926812-141926834 CATAGTGAGAAGTAGGAAGTGGG + Intronic
1000199917 5:158997994-158998016 CAGAATGAGGAGGAGGTAGCAGG - Intronic
1000492331 5:161929682-161929704 CAGTGTGAGGAGGAGAAAATGGG + Intergenic
1001132964 5:169079742-169079764 AGGAGAGAAGAGGAGGAAGAGGG + Intronic
1001281329 5:170388397-170388419 CAGAAAGAAAAGGAAGAAGTGGG + Intronic
1001380303 5:171301814-171301836 CTGAGGGAGGAAGAGGAAGTGGG + Intergenic
1002432066 5:179209402-179209424 GAAAGAGAAGAGGAGTAAGTGGG + Intronic
1002741773 5:181439584-181439606 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1003064858 6:2895239-2895261 CGGAGTGGAGAGGTGGAGGTGGG + Intronic
1003343802 6:5246638-5246660 GAGGGTGAAGTGGAGGGAGTGGG + Intronic
1003724697 6:8747795-8747817 GAGAGTTAAGAGGTTGAAGTTGG + Intergenic
1004127391 6:12887014-12887036 CAAGGGGAAGAGGAGGAAGAGGG - Intronic
1005881716 6:30067373-30067395 CAGGGAGGAGAGGAGGAAGGGGG - Exonic
1005993119 6:30915608-30915630 GAGAGTGGAGAGGAGGGAATTGG - Intronic
1006343367 6:33459723-33459745 CAGCGGGCAGAGGTGGAAGTTGG - Intergenic
1006547707 6:34792876-34792898 CAGACAGAAGAGGAGGAGGTGGG - Intronic
1006656865 6:35602703-35602725 AACAGTGCAGAGGAGGAAGGCGG - Intronic
1006719529 6:36141315-36141337 GAGAGAGAAGGGGAGGAAGTAGG + Intronic
1007261622 6:40568056-40568078 GAGAGAGAAGAGAAGGAAGGGGG - Intronic
1007267075 6:40604675-40604697 AAGAGAGAAGAAGATGAAGTAGG + Intergenic
1007372854 6:41438133-41438155 TAGAGTTAAGGGGAGGAACTAGG + Intergenic
1007517266 6:42422707-42422729 CAGAGTGCAGGGGAAGGAGTTGG - Intronic
1007638472 6:43316046-43316068 CAGATTGGAGTGGAGGAGGTAGG - Intronic
1007761264 6:44134994-44135016 CTGAGGGAAGAGGGGGCAGTTGG - Intronic
1007934626 6:45721893-45721915 CACTATGAAGAGGAAGAAGTAGG - Intergenic
1008016420 6:46525596-46525618 CAGACTGAGGATGAGGAAGAAGG + Intergenic
1008145591 6:47888054-47888076 CAGAGTAAAGAGCAGAGAGTAGG + Intronic
1008484563 6:52021738-52021760 AAGAGGGAAGAGGAAGAAGAAGG - Intronic
1010389279 6:75319069-75319091 GAGGATGAAGAGGAGGAAGAAGG - Intronic
1010549730 6:77206562-77206584 CAAACTGAAGAGGATGAAGATGG - Intergenic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011305391 6:85920313-85920335 CAGAGTTAAGAAGAGGTAGGCGG - Intergenic
1011860967 6:91755720-91755742 AAGAGTGAAGTGGAGAGAGTTGG + Intergenic
1012060787 6:94477328-94477350 TTGAGTGAAGAGGTGAAAGTGGG + Intergenic
1012201488 6:96411674-96411696 GAGAGTGAAGAAGAGAAAGAGGG - Intergenic
1012459532 6:99445018-99445040 CAGAGAGAAGTGGAGAAAGGGGG - Intronic
1012626369 6:101408390-101408412 GAGAGAGAAGAGGAGGGTGTGGG + Intronic
1013619143 6:111872423-111872445 AAGAGTGAAGGGGAGGATGGGGG + Intronic
1013881418 6:114906287-114906309 CGGAGTGAAGATGAAGAGGTGGG - Intergenic
1014089852 6:117391431-117391453 CAGAGTGAGGAGGAGAAGCTGGG + Intronic
1014106698 6:117572426-117572448 TATAGTGAAGAGGACCAAGTTGG - Intronic
1014653125 6:124065992-124066014 GAGATTAAAGAGAAGGAAGTGGG + Intronic
1014760732 6:125354048-125354070 AAGAAAGAAGAGTAGGAAGTAGG + Intergenic
1015227077 6:130869909-130869931 GAGAGTGAGGAGGAAGACGTGGG - Exonic
1016583897 6:145662157-145662179 GAGAGAGAAGAGAAGGAAGTGGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016944272 6:149514192-149514214 CATAGTGAAAAGAGGGAAGTTGG - Intronic
1017394394 6:153979817-153979839 TAGAGGGAAGAGGAGGGAGGGGG - Intergenic
1017953873 6:159161995-159162017 GAGAGTGAAGGGTGGGAAGTGGG + Intergenic
1018038063 6:159898610-159898632 AAGAGGGAGGAGGAGGAAGGAGG - Intergenic
1018038092 6:159898710-159898732 AAGAGGGAGGAGGAGGAAGAGGG - Intergenic
1018266251 6:162027831-162027853 GAAAGTGGAGAGGAGGAAGAAGG + Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018616295 6:165690097-165690119 CACAGAGAATAGGAAGAAGTAGG + Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018791044 6:167147983-167148005 AAGAGGGAGGAGGAGGAAGCAGG - Intronic
1018880968 6:167879928-167879950 CAGATTGATGATCAGGAAGTAGG + Intronic
1018885024 6:167928031-167928053 AAGAGTGTGGAGGTGGAAGTAGG + Intronic
1019089940 6:169520068-169520090 CAGAGACAAAAGGGGGAAGTGGG + Intronic
1019246913 6:170715341-170715363 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019765892 7:2849878-2849900 CAGAGAGAAGAAGAAAAAGTAGG + Intergenic
1019776155 7:2913150-2913172 AAGAGGGAAGAGGAGGAAAGAGG + Intronic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020340174 7:7101519-7101541 CAGAGGGAGCAGGAGGGAGTAGG - Intergenic
1021178897 7:17483341-17483363 CAGGGTGGTGAGGAGGAAGCTGG - Intergenic
1021484533 7:21153078-21153100 GAGATTGGAGAGGAGAAAGTTGG + Intergenic
1021554714 7:21907777-21907799 CAGAGTAAAGCAGGGGAAGTGGG - Intronic
1021853653 7:24832759-24832781 CAGAGCGAAGGGGAGGCAGAAGG + Intronic
1021940529 7:25674419-25674441 GATAGTGATAAGGAGGAAGTGGG + Intergenic
1021960526 7:25868297-25868319 CAAACTGAGGAGGAGGAAGTGGG - Intergenic
1022029270 7:26477544-26477566 GAGACTGCAGAGGAGGAAGGAGG + Intergenic
1022485908 7:30777476-30777498 CAGAGGAAAGAGGAGGCCGTAGG - Intronic
1023375476 7:39551205-39551227 TAGGCTGAAGAGGAGGAAGCGGG - Intergenic
1023482179 7:40645767-40645789 CACAGTGAAGAGGAACAGGTGGG + Intronic
1023836624 7:44072459-44072481 CAGTGAGAAGGGGAGGGAGTTGG + Exonic
1023939809 7:44762131-44762153 CAGGGTGGAGAGCAGGACGTGGG + Intronic
1024019550 7:45353361-45353383 GGGAGGGAAGAGGAGGAAGGGGG + Intergenic
1024178141 7:46861785-46861807 GAGAGTTAAGAGGAGGAGGGTGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024323099 7:48089055-48089077 GAGGGTGGAGAGGAGGAAGGCGG + Intronic
1024393700 7:48843043-48843065 TAGAGGGGAGGGGAGGAAGTAGG + Intergenic
1024936856 7:54719601-54719623 CAGAGTGGGTAGGGGGAAGTGGG - Intergenic
1025195094 7:56926428-56926450 CAGAGTGGAGAGGAGTAAATTGG + Intergenic
1025676858 7:63650515-63650537 CAGAGTGGAGAGGAGTAAATTGG - Intergenic
1026638625 7:72105750-72105772 CAGGGAGAAGAGGAAGAAGAAGG + Intronic
1026662088 7:72311113-72311135 TAGACTGAAGAGGAGGAGGAGGG - Intronic
1027143773 7:75679739-75679761 GAGAGTGCAGAGGACGAAGTGGG - Intronic
1027193267 7:76010462-76010484 CCAAGTTAAGGGGAGGAAGTTGG + Intronic
1027227092 7:76250657-76250679 CAGAGAGATGAGGATTAAGTGGG - Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1028713830 7:93941137-93941159 CAGAGTGAAGAAGGGAAAGAAGG - Intergenic
1028767668 7:94578368-94578390 CATATTGATGAGGCGGAAGTGGG - Intergenic
1028937758 7:96485428-96485450 CAGAGTGAGTAGGAGGAGTTGGG - Intronic
1029200648 7:98837052-98837074 CAGAGTGACCAGGTGGAGGTTGG - Intergenic
1030045249 7:105489451-105489473 CAGAGTGAAGGGGCAGGAGTGGG - Intronic
1030264131 7:107599934-107599956 CAGAGTGGAGATGGGTAAGTGGG - Intronic
1030560847 7:111083981-111084003 AAGAGTGAACAGTAAGAAGTAGG + Intronic
1030810449 7:113966316-113966338 CAGAGTGAGGAGGATGAAAGAGG + Intronic
1031601209 7:123712777-123712799 TAGAGGGAATAGGAGGAAGTGGG - Intronic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1032090492 7:128909297-128909319 CAGAGAGAGGAGGAGGGAGAGGG + Intronic
1032466447 7:132148627-132148649 CAGAGTGGCGACAAGGAAGTGGG - Exonic
1032503235 7:132415633-132415655 GAGAGTGAGGAGGAGAAAGAGGG - Intronic
1032815293 7:135467807-135467829 CAGAGAGAAAACAAGGAAGTTGG + Intronic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1033143978 7:138855097-138855119 CAGGGTGAAGGGGAGGGAGGGGG + Intronic
1033172172 7:139093911-139093933 CAGAGTGATCAGAAGAAAGTCGG - Intronic
1034030045 7:147751339-147751361 CAGAGATAAGTGGAGGAATTAGG + Intronic
1034380460 7:150687875-150687897 GAGAGTGAGGAGGAGGGAGTGGG - Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034744764 7:153513994-153514016 CAGTGTGGAGAAGAGGAAGGAGG + Intergenic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1034889010 7:154822775-154822797 CAGGATGAAGAGCAGGAAATAGG - Intronic
1035120495 7:156562811-156562833 CAGAATGAGGAAGAGGAAATTGG + Intergenic
1035501228 8:92612-92634 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
1036242704 8:7092844-7092866 CAGAGTTGAGAGGAGGCAGATGG + Intergenic
1036604504 8:10293716-10293738 GAGAGGGAAGGGGAGGAAGCAGG - Intronic
1036653685 8:10662064-10662086 AAGAGTGAAGTGGGGGCAGTAGG - Intronic
1036746959 8:11416739-11416761 CAGGCAGAAGAGGAGGAAGTTGG - Intronic
1036899111 8:12658594-12658616 CAGAGTTGAGAGGAGGCAGATGG - Intergenic
1037041683 8:14244198-14244220 AAGAAGGAAGAGGAGGAAGAAGG - Intronic
1037187230 8:16078717-16078739 GAGAATGATGAGGAGGCAGTTGG + Intergenic
1037527399 8:19740255-19740277 CAGAGTGAAGGGGAGCAGCTGGG - Intronic
1037622079 8:20573089-20573111 CAGGGAGCAGAGGAGGAAGCAGG - Intergenic
1037716812 8:21407904-21407926 CAGAGTGGGGAGGAGGAAGGTGG - Intergenic
1037826943 8:22165275-22165297 CAGAGGGAAGGGGAAGAGGTCGG + Exonic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1038546212 8:28427504-28427526 CAGAGTTAAGAGGGTGAAGAAGG - Intronic
1038665024 8:29530357-29530379 CAGAGGGAAGAGGAGGTCCTTGG + Intergenic
1039339701 8:36634138-36634160 CAGAATGCAGAGGAGGAAGCTGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039518465 8:38152131-38152153 CAGAGAGAAGAGGAGGGCCTGGG + Intergenic
1040914976 8:52559470-52559492 GAGAGTGAGGAGGAGAAAGGTGG - Intronic
1041023694 8:53662365-53662387 CAGGGGGAAGAGGAGGAAATTGG + Intergenic
1041731968 8:61071447-61071469 CTGACTGCATAGGAGGAAGTAGG - Intronic
1042237818 8:66631750-66631772 CAGAGTGAAGCGGGAGAAATGGG + Exonic
1042811003 8:72824843-72824865 CAGAGTGCAGAGTAGAGAGTGGG - Intronic
1043065271 8:75561632-75561654 CAGACTGAAGAGTTGGCAGTGGG + Intronic
1044055420 8:87563929-87563951 CACAGGGAAGGGGAGGAAATGGG - Intronic
1044847775 8:96398882-96398904 GAGAGTGAAAAGGAGGAGGAGGG - Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1046936901 8:119893322-119893344 CACAGAGAAGGAGAGGAAGTTGG + Intronic
1047017776 8:120741854-120741876 GAGAAGGAAGAGGAGAAAGTGGG + Intronic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1047302109 8:123622377-123622399 CAGAGGGAATAGGAAGAAGCAGG + Intergenic
1047636371 8:126767600-126767622 CAGCCTGAGCAGGAGGAAGTTGG - Intergenic
1047693699 8:127382546-127382568 CAGAGGGAAGAAAAGGCAGTAGG + Intergenic
1048036865 8:130685273-130685295 CAGAAGGAAGAGGAAGAAGGGGG + Intergenic
1048305715 8:133283173-133283195 CATTTTGTAGAGGAGGAAGTTGG - Intronic
1048376718 8:133828906-133828928 GACAGTGCAGAGGAGAAAGTTGG - Intergenic
1048727768 8:137406552-137406574 CAGAGGGAAGAGGAGGTAAAAGG - Intergenic
1048931859 8:139321539-139321561 GAGACTGATGAGGAGGAATTTGG + Intergenic
1049340484 8:142109728-142109750 CAGGGTGCAGAGGAGGCAGCTGG - Intergenic
1050039575 9:1475312-1475334 CAGTGGGATGAGGAGCAAGTGGG - Intergenic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1050298561 9:4232703-4232725 CATAATAAAGATGAGGAAGTTGG + Intronic
1051500217 9:17768584-17768606 CAGAGTGAACAAGAGGGAGAAGG - Intronic
1052866297 9:33466477-33466499 CAGAGTCAGGAGTTGGAAGTGGG + Intronic
1053387746 9:37707978-37708000 CAGGGTGGAGAGGAGCAGGTGGG + Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053537130 9:38937318-38937340 CAGAGTGGAGAAGAGAAACTGGG + Intergenic
1054629005 9:67426612-67426634 CAGAGTGGAGAAGAGAAACTGGG - Intergenic
1054728436 9:68676400-68676422 GAGAGTGAAGAGTTGGCAGTGGG - Intergenic
1054770442 9:69078435-69078457 CTGAGAGAAAAGGAGGAAGGTGG - Intronic
1054910030 9:70446139-70446161 CAGAGAGCAGAAGAGGAAGTGGG - Intergenic
1055513790 9:77018366-77018388 CAGAGAGAAGAGAAGCAAGAAGG + Intergenic
1055766427 9:79668375-79668397 CTGACTGAAGTGGAGGATGTCGG + Intronic
1056226668 9:84502290-84502312 GAGGGTGAGGAGGGGGAAGTGGG + Intergenic
1056831816 9:89923383-89923405 CAGAGTGAAGCCCAGCAAGTGGG + Intergenic
1057255199 9:93540751-93540773 CAGAGTGAAGAGGAGGTCACAGG - Intronic
1057276418 9:93678122-93678144 CAGAAAGAGGAGGAGCAAGTGGG + Exonic
1057606431 9:96500987-96501009 TAGAGAGGAGGGGAGGAAGTAGG + Exonic
1057936002 9:99239468-99239490 CACAGTGAAGAGGGGGAACAAGG + Intergenic
1057962223 9:99467807-99467829 GAGAAAGAAGAGGAGGAAGATGG + Intergenic
1058161858 9:101578790-101578812 CAGAGAGAACAGGGGCAAGTGGG + Intronic
1058171547 9:101687048-101687070 CTGGGTAAGGAGGAGGAAGTCGG + Exonic
1058742183 9:107954904-107954926 GAGAGGAAAGAGGAGGAAGGAGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059035198 9:110747189-110747211 CAGATTGAAAAGGTGGTAGTTGG + Intronic
1059379252 9:113910339-113910361 CAGAGTGAAGAGCAGGAACCAGG - Intronic
1059949597 9:119448574-119448596 CAGACTGAAGAGGAGGATTGAGG - Intergenic
1059979953 9:119760621-119760643 AAGAGTGAAGAGAAGAAATTGGG - Intergenic
1060050064 9:120372133-120372155 AAGGCTGAGGAGGAGGAAGTGGG - Intergenic
1061022175 9:128023058-128023080 CAGAGGGTAGAGGAGGAAGTGGG - Intergenic
1061074452 9:128332651-128332673 AAGAGTGAACAGAAGGGAGTAGG - Intronic
1061504693 9:131025285-131025307 ATGAGGGAAGAGGAGGAATTGGG + Intronic
1061518962 9:131106172-131106194 CACAGTACTGAGGAGGAAGTGGG - Exonic
1061605622 9:131708474-131708496 CAGCTTGAGGAGGAGGAAGTTGG - Intronic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1062254321 9:135613974-135613996 AAGAGGGCAGAGGAGGACGTGGG - Intergenic
1062275809 9:135730056-135730078 CACAGTGCAGAGGAGAATGTGGG - Intronic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1062574799 9:137201031-137201053 GAGAGCGCAGAGGCGGAAGTGGG - Intronic
1062697669 9:137883799-137883821 CAGATGGAAGAGGAGGGAGCAGG + Intronic
1203738660 Un_GL000216v2:160865-160887 CAGAGAGACGAAGAGGAAGGGGG - Intergenic
1203607684 Un_KI270748v1:70800-70822 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1203639488 Un_KI270750v1:146751-146773 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1185707243 X:2276956-2276978 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707280 X:2277134-2277156 GAGAAGGAAGAGGAGGAAATAGG + Intronic
1185707298 X:2277223-2277245 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707316 X:2277312-2277334 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707353 X:2277491-2277513 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707468 X:2278025-2278047 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707527 X:2278290-2278312 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707626 X:2278735-2278757 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707760 X:2279358-2279380 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707779 X:2279443-2279465 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707798 X:2279530-2279552 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707816 X:2279619-2279641 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707835 X:2279704-2279726 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707854 X:2279789-2279811 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185707953 X:2280234-2280256 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185708087 X:2280857-2280879 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185708106 X:2280942-2280964 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185708125 X:2281029-2281051 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185708143 X:2281118-2281140 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185708162 X:2281203-2281225 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185708181 X:2281290-2281312 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185708199 X:2281379-2281401 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185708218 X:2281464-2281486 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185708317 X:2281910-2281932 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185708376 X:2282175-2282197 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1185708395 X:2282264-2282286 GAGAAGGAAGAGGAGGAAATGGG + Intronic
1187377118 X:18764980-18765002 AAGATTGAACAGGAGGAGGTGGG + Intronic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1188048137 X:25451535-25451557 TAGAGGGAAGAGGAGGATCTGGG + Intergenic
1188311868 X:28627056-28627078 AAAAGTGAAGAAGTGGAAGTTGG + Intronic
1188396464 X:29689940-29689962 TAGAATGAATAAGAGGAAGTAGG + Intronic
1188698676 X:33231704-33231726 AAGAGTCAAGTGAAGGAAGTAGG + Intronic
1188947537 X:36325587-36325609 CTGAGGGAAGAGGATGAAGCAGG + Intronic
1188988058 X:36785563-36785585 CAGACTGAAGAGGAAGACCTTGG + Intergenic
1189021351 X:37345005-37345027 CTCAGTGAAGAGGAAGATGTAGG + Intergenic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1189911287 X:45812849-45812871 CAGAAAGAAGAGGAGGGAGGAGG + Intergenic
1190150317 X:47941238-47941260 GAGAGTGAATATGAGGAGGTGGG - Intronic
1190187664 X:48250100-48250122 CAGAGGGCAGAGGAAGAGGTAGG - Intronic
1190209047 X:48429749-48429771 CAGAGGGCAGAGGGAGAAGTAGG + Intergenic
1190463152 X:50698907-50698929 CAGAGTTAGGAGGAGGAAGGTGG - Intronic
1190661908 X:52662444-52662466 CAGAGGGCAGAGGAAGAGGTAGG - Intronic
1190909703 X:54759348-54759370 CAGAGTTGACAGGAGGCAGTGGG + Intronic
1191671713 X:63754678-63754700 TAGAAAGGAGAGGAGGAAGTAGG + Exonic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192205464 X:69093137-69093159 CAGAGTGATGAGGCAGAAGCTGG + Intergenic
1192233653 X:69282958-69282980 CAGATTGAAGATGAGGAGCTGGG + Intergenic
1192243907 X:69357867-69357889 CATCCTGAAGAGGAGGAAGGAGG - Intergenic
1193601539 X:83512576-83512598 CAGAATGGAGAGGAAGAAGAAGG - Intergenic
1194173064 X:90612570-90612592 CAGTGAAAAGGGGAGGAAGTAGG - Intergenic
1194456987 X:94116775-94116797 AAGAGTGAAGAGGAAGAAAATGG + Intergenic
1194530236 X:95038671-95038693 TAGAGTGAAGAAAATGAAGTAGG - Intergenic
1194844382 X:98786304-98786326 CAGATTCAAGAGGAGGAAACAGG - Intergenic
1195082552 X:101385268-101385290 GAGTGGGAAGAGGAGGAGGTTGG + Intronic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196495112 X:116315970-116315992 CAAAGTGCAAAGGAGAAAGTGGG + Intergenic
1196865202 X:120065075-120065097 CAGGGGGCAGAGGAGGAAGCAGG + Intergenic
1196877891 X:120171205-120171227 CAGGGGGCAGAGGAGGAAGCAGG - Intergenic
1197348109 X:125349307-125349329 AAGAGGGAAGAGGTGGTAGTTGG + Intergenic
1197546340 X:127829349-127829371 CAGAATTAAAAGGAGAAAGTTGG - Intergenic
1197675291 X:129323352-129323374 CACAGTAAAGAGGAGAAACTGGG + Intergenic
1197713470 X:129688862-129688884 CTGAGGGAAGAGCAGGAAGTAGG - Intergenic
1199039312 X:143092658-143092680 TAGACTGAAGACGAGGAAGCTGG + Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1200253107 X:154564278-154564300 CAGAGGGAAGGGGAGGATGGAGG - Intronic
1200264660 X:154640137-154640159 CAGAGGGAAGGGGAGGATGGAGG + Intergenic
1200325753 X:155237135-155237157 CAGAGAGAAGAGGTGGGAGTGGG + Intronic
1201107126 Y:10771593-10771615 TGGAGTGAAGAGGAGTAAATTGG - Intergenic
1201668245 Y:16484035-16484057 CAGAGTGAAGAGGCAGAATGAGG - Intergenic
1202575903 Y:26324621-26324643 CTAAGTGAAGAGAAGGGAGTGGG - Intergenic