ID: 1058916268

View in Genome Browser
Species Human (GRCh38)
Location 9:109568754-109568776
Sequence GAGGGCTGTTGCCAGTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058916260_1058916268 12 Left 1058916260 9:109568719-109568741 CCAGTGAAGTGCTTTTGCCAGCA No data
Right 1058916268 9:109568754-109568776 GAGGGCTGTTGCCAGTGGACTGG No data
1058916258_1058916268 17 Left 1058916258 9:109568714-109568736 CCAGCCCAGTGAAGTGCTTTTGC No data
Right 1058916268 9:109568754-109568776 GAGGGCTGTTGCCAGTGGACTGG No data
1058916263_1058916268 -5 Left 1058916263 9:109568736-109568758 CCAGCACCTCCTGCATTGGAGGG No data
Right 1058916268 9:109568754-109568776 GAGGGCTGTTGCCAGTGGACTGG No data
1058916257_1058916268 20 Left 1058916257 9:109568711-109568733 CCACCAGCCCAGTGAAGTGCTTT No data
Right 1058916268 9:109568754-109568776 GAGGGCTGTTGCCAGTGGACTGG No data
1058916259_1058916268 13 Left 1058916259 9:109568718-109568740 CCCAGTGAAGTGCTTTTGCCAGC No data
Right 1058916268 9:109568754-109568776 GAGGGCTGTTGCCAGTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058916268 Original CRISPR GAGGGCTGTTGCCAGTGGAC TGG Intergenic
No off target data available for this crispr