ID: 1058920321

View in Genome Browser
Species Human (GRCh38)
Location 9:109608284-109608306
Sequence TTGTTGAATAATAGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058920321_1058920327 29 Left 1058920321 9:109608284-109608306 CCTTTTTTCCTATTATTCAACAA No data
Right 1058920327 9:109608336-109608358 AGACTGAATTCGGAGAATTAGGG No data
1058920321_1058920323 3 Left 1058920321 9:109608284-109608306 CCTTTTTTCCTATTATTCAACAA No data
Right 1058920323 9:109608310-109608332 TTTGTCATATGCCAACTATGTGG No data
1058920321_1058920325 19 Left 1058920321 9:109608284-109608306 CCTTTTTTCCTATTATTCAACAA No data
Right 1058920325 9:109608326-109608348 TATGTGGCAGAGACTGAATTCGG No data
1058920321_1058920326 28 Left 1058920321 9:109608284-109608306 CCTTTTTTCCTATTATTCAACAA No data
Right 1058920326 9:109608335-109608357 GAGACTGAATTCGGAGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058920321 Original CRISPR TTGTTGAATAATAGGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr