ID: 1058920323

View in Genome Browser
Species Human (GRCh38)
Location 9:109608310-109608332
Sequence TTTGTCATATGCCAACTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058920321_1058920323 3 Left 1058920321 9:109608284-109608306 CCTTTTTTCCTATTATTCAACAA No data
Right 1058920323 9:109608310-109608332 TTTGTCATATGCCAACTATGTGG No data
1058920314_1058920323 23 Left 1058920314 9:109608264-109608286 CCTTCCTTCCTTCCCTCCTCCCT 0: 36
1: 2149
2: 41374
3: 37767
4: 53002
Right 1058920323 9:109608310-109608332 TTTGTCATATGCCAACTATGTGG No data
1058920322_1058920323 -5 Left 1058920322 9:109608292-109608314 CCTATTATTCAACAAATATTTGT No data
Right 1058920323 9:109608310-109608332 TTTGTCATATGCCAACTATGTGG No data
1058920317_1058920323 11 Left 1058920317 9:109608276-109608298 CCCTCCTCCCTTTTTTCCTATTA No data
Right 1058920323 9:109608310-109608332 TTTGTCATATGCCAACTATGTGG No data
1058920319_1058920323 7 Left 1058920319 9:109608280-109608302 CCTCCCTTTTTTCCTATTATTCA No data
Right 1058920323 9:109608310-109608332 TTTGTCATATGCCAACTATGTGG No data
1058920318_1058920323 10 Left 1058920318 9:109608277-109608299 CCTCCTCCCTTTTTTCCTATTAT No data
Right 1058920323 9:109608310-109608332 TTTGTCATATGCCAACTATGTGG No data
1058920320_1058920323 4 Left 1058920320 9:109608283-109608305 CCCTTTTTTCCTATTATTCAACA No data
Right 1058920323 9:109608310-109608332 TTTGTCATATGCCAACTATGTGG No data
1058920315_1058920323 19 Left 1058920315 9:109608268-109608290 CCTTCCTTCCCTCCTCCCTTTTT No data
Right 1058920323 9:109608310-109608332 TTTGTCATATGCCAACTATGTGG No data
1058920316_1058920323 15 Left 1058920316 9:109608272-109608294 CCTTCCCTCCTCCCTTTTTTCCT No data
Right 1058920323 9:109608310-109608332 TTTGTCATATGCCAACTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058920323 Original CRISPR TTTGTCATATGCCAACTATG TGG Intergenic
No off target data available for this crispr