ID: 1058920325

View in Genome Browser
Species Human (GRCh38)
Location 9:109608326-109608348
Sequence TATGTGGCAGAGACTGAATT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058920317_1058920325 27 Left 1058920317 9:109608276-109608298 CCCTCCTCCCTTTTTTCCTATTA No data
Right 1058920325 9:109608326-109608348 TATGTGGCAGAGACTGAATTCGG No data
1058920318_1058920325 26 Left 1058920318 9:109608277-109608299 CCTCCTCCCTTTTTTCCTATTAT No data
Right 1058920325 9:109608326-109608348 TATGTGGCAGAGACTGAATTCGG No data
1058920319_1058920325 23 Left 1058920319 9:109608280-109608302 CCTCCCTTTTTTCCTATTATTCA No data
Right 1058920325 9:109608326-109608348 TATGTGGCAGAGACTGAATTCGG No data
1058920322_1058920325 11 Left 1058920322 9:109608292-109608314 CCTATTATTCAACAAATATTTGT No data
Right 1058920325 9:109608326-109608348 TATGTGGCAGAGACTGAATTCGG No data
1058920320_1058920325 20 Left 1058920320 9:109608283-109608305 CCCTTTTTTCCTATTATTCAACA No data
Right 1058920325 9:109608326-109608348 TATGTGGCAGAGACTGAATTCGG No data
1058920321_1058920325 19 Left 1058920321 9:109608284-109608306 CCTTTTTTCCTATTATTCAACAA No data
Right 1058920325 9:109608326-109608348 TATGTGGCAGAGACTGAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058920325 Original CRISPR TATGTGGCAGAGACTGAATT CGG Intergenic
No off target data available for this crispr