ID: 1058920327

View in Genome Browser
Species Human (GRCh38)
Location 9:109608336-109608358
Sequence AGACTGAATTCGGAGAATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058920324_1058920327 -8 Left 1058920324 9:109608321-109608343 CCAACTATGTGGCAGAGACTGAA No data
Right 1058920327 9:109608336-109608358 AGACTGAATTCGGAGAATTAGGG No data
1058920321_1058920327 29 Left 1058920321 9:109608284-109608306 CCTTTTTTCCTATTATTCAACAA No data
Right 1058920327 9:109608336-109608358 AGACTGAATTCGGAGAATTAGGG No data
1058920322_1058920327 21 Left 1058920322 9:109608292-109608314 CCTATTATTCAACAAATATTTGT No data
Right 1058920327 9:109608336-109608358 AGACTGAATTCGGAGAATTAGGG No data
1058920320_1058920327 30 Left 1058920320 9:109608283-109608305 CCCTTTTTTCCTATTATTCAACA No data
Right 1058920327 9:109608336-109608358 AGACTGAATTCGGAGAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058920327 Original CRISPR AGACTGAATTCGGAGAATTA GGG Intergenic
No off target data available for this crispr