ID: 1058923116

View in Genome Browser
Species Human (GRCh38)
Location 9:109637063-109637085
Sequence AAAGCTAGTAAATGTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058923114_1058923116 13 Left 1058923114 9:109637027-109637049 CCTGAGACTTAGGTTAAGTAATA No data
Right 1058923116 9:109637063-109637085 AAAGCTAGTAAATGTAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058923116 Original CRISPR AAAGCTAGTAAATGTAAAGC TGG Intergenic
No off target data available for this crispr