ID: 1058935653

View in Genome Browser
Species Human (GRCh38)
Location 9:109767326-109767348
Sequence CCACCCTAATACCACTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058935645_1058935653 -4 Left 1058935645 9:109767307-109767329 CCGCCCCACCGGCCTGTGCCCAC 0: 1
1: 0
2: 3
3: 62
4: 497
Right 1058935653 9:109767326-109767348 CCACCCTAATACCACTTCCTTGG No data
1058935639_1058935653 29 Left 1058935639 9:109767274-109767296 CCTGGCTTTGTCCAAACATTAGT 0: 1
1: 0
2: 1
3: 12
4: 122
Right 1058935653 9:109767326-109767348 CCACCCTAATACCACTTCCTTGG No data
1058935642_1058935653 18 Left 1058935642 9:109767285-109767307 CCAAACATTAGTTCCATCAGGGC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1058935653 9:109767326-109767348 CCACCCTAATACCACTTCCTTGG No data
1058935647_1058935653 -8 Left 1058935647 9:109767311-109767333 CCCACCGGCCTGTGCCCACCCTA 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1058935653 9:109767326-109767348 CCACCCTAATACCACTTCCTTGG No data
1058935648_1058935653 -9 Left 1058935648 9:109767312-109767334 CCACCGGCCTGTGCCCACCCTAA 0: 1
1: 0
2: 0
3: 22
4: 232
Right 1058935653 9:109767326-109767348 CCACCCTAATACCACTTCCTTGG No data
1058935646_1058935653 -7 Left 1058935646 9:109767310-109767332 CCCCACCGGCCTGTGCCCACCCT 0: 1
1: 0
2: 4
3: 37
4: 371
Right 1058935653 9:109767326-109767348 CCACCCTAATACCACTTCCTTGG No data
1058935644_1058935653 5 Left 1058935644 9:109767298-109767320 CCATCAGGGCCGCCCCACCGGCC 0: 1
1: 0
2: 0
3: 24
4: 378
Right 1058935653 9:109767326-109767348 CCACCCTAATACCACTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058935653 Original CRISPR CCACCCTAATACCACTTCCT TGG Intronic
No off target data available for this crispr