ID: 1058937114

View in Genome Browser
Species Human (GRCh38)
Location 9:109779943-109779965
Sequence GCGTGGACACGCGCTTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058937114_1058937121 9 Left 1058937114 9:109779943-109779965 CCCCAGCAAGCGCGTGTCCACGC 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1058937121 9:109779975-109779997 ACGCCAGCCGTGCGCCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058937114 Original CRISPR GCGTGGACACGCGCTTGCTG GGG (reversed) Intronic
900655525 1:3754945-3754967 CCGTGGAGACCCTCTTGCTGAGG - Intronic
902216440 1:14937200-14937222 GCATAGACACAGGCTTGCTGAGG - Intronic
903664434 1:24997763-24997785 GCCTAGAGACGTGCTTGCTGGGG - Intergenic
910485258 1:87706007-87706029 GTGTGGACAGGGGCTTGCTTGGG + Intergenic
921029926 1:211327628-211327650 TCGGGGCCACGCTCTTGCTGCGG + Intronic
922340479 1:224650932-224650954 GCGTGGACACTGGCTTGATGGGG + Intronic
1077112221 11:866834-866856 GGGTGGCCACGTGCTGGCTGCGG + Exonic
1084529159 11:69717004-69717026 GGATGGACACGGGCTTGCAGAGG + Intergenic
1093140814 12:15508609-15508631 ACGTGGACACTCACGTGCTGCGG - Exonic
1115217331 14:31026249-31026271 GGGTGGCCCCGCGCTGGCTGCGG + Exonic
1122873544 14:104652252-104652274 GGGTGGACACACACTTGGTGGGG - Intergenic
1125722358 15:41851415-41851437 GCGTGGACAGGCCCTAGCTCTGG - Intronic
1132840632 16:1976988-1977010 GTGTGGCCAAGCCCTTGCTGGGG + Intronic
1132854964 16:2040618-2040640 GCTTGGACAAACGCTTGCTGGGG + Intronic
1133142495 16:3757622-3757644 GGGTGTACAGGCGCTTACTGAGG - Intronic
1149553088 17:57554481-57554503 GTGTGCACACGCGCTTGTTTGGG + Intronic
1151468825 17:74305135-74305157 GCATGGACAGGAGCTTGCTTGGG - Intronic
1152136121 17:78504717-78504739 GCCGGGGGACGCGCTTGCTGGGG + Intronic
1159903464 18:74069339-74069361 GTGTGGAGAGGGGCTTGCTGTGG - Intergenic
926061475 2:9807641-9807663 GGGTGGAGACGGCCTTGCTGGGG - Intergenic
946368592 2:219266538-219266560 GCCTGGACAGGGGCTGGCTGGGG - Intronic
948052688 2:234990578-234990600 GCGTGGACCAGCTCTTGGTGTGG + Intronic
948616617 2:239203226-239203248 GGGTGGGCACCCACTTGCTGGGG - Intronic
1175408768 20:58752449-58752471 GTGTGGACGTCCGCTTGCTGTGG - Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1181235400 22:21445375-21445397 CCGTGGACAGCCGCTGGCTGCGG - Exonic
1183272624 22:36871646-36871668 GTGGGGACACGCTCTTGCTGTGG - Exonic
952392555 3:32892847-32892869 GGGTGGACATGCGTGTGCTGAGG + Exonic
962337628 3:134550628-134550650 GAGTAGAAACACGCTTGCTGTGG + Intronic
968488623 4:877512-877534 CCGGGGACAGGCGCTTGCTGAGG - Intronic
969217645 4:5734998-5735020 CTGTGGACACTCGCTGGCTGTGG - Intronic
971196299 4:24473464-24473486 GCGTGGACACGCGCGCGGGGGGG - Intergenic
973821372 4:54664529-54664551 ACTTGGACACTCCCTTGCTGTGG + Intronic
981128607 4:141133374-141133396 GCCTGGGCACGCACTTGCCGCGG + Intronic
1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG + Exonic
1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG + Intronic
1031669463 7:124525134-124525156 GGGTGCACACGTGTTTGCTGTGG + Intergenic
1049291480 8:141805261-141805283 GGGTGGACACGGGCTTGGAGTGG - Intergenic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1053285703 9:36848333-36848355 GTGTGGACACGCTCTGCCTGTGG - Intronic
1057028546 9:91755918-91755940 GGGTGGCCACGTGCTTGCTTAGG - Intronic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1061303568 9:129720152-129720174 GCGGGGAGAGGCGCTTGCTGAGG - Intronic
1061303573 9:129720179-129720201 GCGGGGAGAGGCGCTTGCTGAGG - Intronic
1186747421 X:12583872-12583894 GCCTGGACGCCCGCTTTCTGAGG - Intronic