ID: 1058937121

View in Genome Browser
Species Human (GRCh38)
Location 9:109779975-109779997
Sequence ACGCCAGCCGTGCGCCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058937116_1058937121 7 Left 1058937116 9:109779945-109779967 CCAGCAAGCGCGTGTCCACGCGG 0: 1
1: 0
2: 1
3: 0
4: 29
Right 1058937121 9:109779975-109779997 ACGCCAGCCGTGCGCCCCAGCGG No data
1058937114_1058937121 9 Left 1058937114 9:109779943-109779965 CCCCAGCAAGCGCGTGTCCACGC 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1058937121 9:109779975-109779997 ACGCCAGCCGTGCGCCCCAGCGG No data
1058937119_1058937121 -8 Left 1058937119 9:109779960-109779982 CCACGCGGGCGCGCCACGCCAGC 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1058937121 9:109779975-109779997 ACGCCAGCCGTGCGCCCCAGCGG No data
1058937113_1058937121 12 Left 1058937113 9:109779940-109779962 CCGCCCCAGCAAGCGCGTGTCCA 0: 1
1: 0
2: 0
3: 14
4: 88
Right 1058937121 9:109779975-109779997 ACGCCAGCCGTGCGCCCCAGCGG No data
1058937115_1058937121 8 Left 1058937115 9:109779944-109779966 CCCAGCAAGCGCGTGTCCACGCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1058937121 9:109779975-109779997 ACGCCAGCCGTGCGCCCCAGCGG No data
1058937112_1058937121 15 Left 1058937112 9:109779937-109779959 CCTCCGCCCCAGCAAGCGCGTGT 0: 1
1: 1
2: 1
3: 7
4: 69
Right 1058937121 9:109779975-109779997 ACGCCAGCCGTGCGCCCCAGCGG No data
1058937111_1058937121 28 Left 1058937111 9:109779924-109779946 CCACTGCGCTCTGCCTCCGCCCC 0: 1
1: 0
2: 4
3: 87
4: 788
Right 1058937121 9:109779975-109779997 ACGCCAGCCGTGCGCCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058937121 Original CRISPR ACGCCAGCCGTGCGCCCCAG CGG Intronic
No off target data available for this crispr