ID: 1058937241

View in Genome Browser
Species Human (GRCh38)
Location 9:109780402-109780424
Sequence GAAACTGATGGGCACCCCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058937241 Original CRISPR GAAACTGATGGGCACCCCGG GGG (reversed) Exonic
900197041 1:1381722-1381744 GAAACTGATGGGAGCTCAGGGGG - Intergenic
903023691 1:20411923-20411945 GAACCTGATGGGCAGCACGTGGG - Intergenic
903334671 1:22616911-22616933 GACACTGATGAGACCCCCGGCGG - Intergenic
905136666 1:35805787-35805809 GAAAATGATGTGAACCCGGGAGG + Intergenic
908163897 1:61438442-61438464 TAATATGATGAGCACCCCGGAGG + Intronic
916805107 1:168251473-168251495 GAAATTGAAGGGCAGCCCAGTGG + Exonic
920567057 1:206982424-206982446 GAAACATATGGTCACCCCTGGGG + Intergenic
921159154 1:212460834-212460856 GAGAGTGATGAGCACCCCGCTGG - Intergenic
923902123 1:238337673-238337695 GAAAATGGTGTGAACCCCGGAGG - Intergenic
1065741418 10:28800492-28800514 GTGACTGATGGGGACTCCGGTGG - Intergenic
1067812498 10:49440771-49440793 GAAACTGGTGAGCAGCCAGGCGG + Intergenic
1069654716 10:70079309-70079331 GATTCTGATGGGCAGCCAGGTGG + Intronic
1070914611 10:80144823-80144845 GGAACTGCTGGGCACCACGGGGG + Intronic
1073533689 10:104255265-104255287 GAATCAGGTGGGCACCCAGGCGG + Exonic
1079723578 11:23849977-23849999 GAAACTGGTGTGAACCCAGGAGG - Intergenic
1080853997 11:36095881-36095903 GAAGCTGAAGGCCACCACGGTGG + Intronic
1084626629 11:70312790-70312812 CAAAGTGCTGGGCACCCAGGGGG - Intronic
1093394728 12:18667360-18667382 TAAACTGATGGGCACCTGGTGGG + Intergenic
1098319259 12:69224554-69224576 GAAAATGATGTGAACCCGGGAGG + Intergenic
1101966893 12:109287840-109287862 GTACCTGCTGGGCACCCGGGGGG + Exonic
1112336663 13:98522300-98522322 GAAACTACCGGGCACCCCTGGGG - Intronic
1118176760 14:63448205-63448227 GAGACTGGTGTGAACCCCGGAGG + Intronic
1129307775 15:74680169-74680191 GAGAATGATGGGAACCCAGGAGG + Intronic
1133191637 16:4137997-4138019 AAAGCTGATGGGCACCCGGCAGG + Intergenic
1133233152 16:4375858-4375880 GATTCTGATGTGCAGCCCGGCGG + Intronic
1134790366 16:16984222-16984244 TAAACTGATGTGCACTCAGGAGG - Intergenic
1137672263 16:50285813-50285835 GAGACTGATGGGGATCCCTGGGG + Intronic
1139324082 16:66138454-66138476 AAACCTGATGTGCACACCGGAGG + Intergenic
1143733339 17:8893803-8893825 CAAACTGCTAGGCACCCTGGAGG - Intronic
1145885452 17:28379398-28379420 GAAACTGGTGTGAACCCAGGAGG - Intronic
1146884466 17:36461926-36461948 GAGACTGCTGGGCACACCGTGGG - Intergenic
1147045672 17:37750123-37750145 GAGACTGGTGTGAACCCCGGAGG + Intergenic
1147399672 17:40172774-40172796 GAGAATGATGGGAACCCGGGAGG + Intergenic
1151730321 17:75907202-75907224 GAAGCTGCTGGCCACCCAGGTGG + Intronic
1157684962 18:49635507-49635529 GAAAATGATGTGAACCCAGGAGG - Intergenic
1161005635 19:1934710-1934732 GAAAATGGTGGGAACCCGGGAGG + Intergenic
1161369479 19:3902511-3902533 GGAACTGCTTGGCAGCCCGGTGG + Exonic
1163833439 19:19558946-19558968 GAGTCTAATGGGCACCCCCGAGG + Intergenic
1165462494 19:35952429-35952451 GAGAGTGAAGTGCACCCCGGGGG - Intergenic
926092850 2:10061671-10061693 GAAGCTGACGGGCAGCCCTGGGG + Intronic
926634341 2:15164274-15164296 GAACCTGGTGGGCATCCTGGAGG - Intergenic
932885317 2:75543774-75543796 CAAACTGCTGAGCTCCCCGGAGG + Intronic
936116471 2:109706840-109706862 GAAAGTGAGGGGCAACCCGCTGG - Intergenic
938092146 2:128441016-128441038 GCATCTGATGGGCTCCCCTGGGG - Intergenic
939676434 2:145078186-145078208 GAAAGAGATGGGCAAGCCGGAGG - Intergenic
940804725 2:158173969-158173991 GAAACTGATGGGCTGCCTGTGGG - Intronic
946301675 2:218827965-218827987 GAATCTTATGGGCACCCAGAGGG - Intronic
946339758 2:219059736-219059758 GAAACTTTTCGGCACCCCTGAGG - Intronic
946931666 2:224677414-224677436 GAGAATGATGGGAACCCAGGAGG - Intergenic
948933457 2:241147847-241147869 GAAACTGATGGGACCCTCTGCGG + Intronic
1168831473 20:847415-847437 AAAACTGCTGGGCACCATGGGGG - Intronic
1170206409 20:13803237-13803259 GGAACTGAAGAGAACCCCGGAGG + Intronic
1172744507 20:37196316-37196338 GAGACTGATGTGAACCCGGGAGG - Intronic
1179023206 21:37657652-37657674 GAAAGTGAGGGGCACCCCTCTGG - Intronic
1184755894 22:46515553-46515575 CAAGCTGCAGGGCACCCCGGGGG + Intronic
1185043144 22:48515880-48515902 GAGACTGATGGAGACCCCTGGGG - Intronic
1185053745 22:48567293-48567315 GAAACAGATGGGCACACACGAGG - Intronic
952948329 3:38496394-38496416 GAAAACGACGGGAACCCCGGAGG - Exonic
953692824 3:45134212-45134234 GAGAATGATGTGAACCCCGGAGG - Intronic
954609498 3:51936861-51936883 GCAACGGATGGGAACCCAGGAGG + Intronic
964550318 3:157878051-157878073 GAAACTGAGGGGCACTCCAATGG + Intergenic
965715044 3:171594009-171594031 GACACTGAAGGTCACCCCTGGGG - Intergenic
968402724 4:312519-312541 GAAAATGATGTGAACCCGGGAGG + Intergenic
969121352 4:4913728-4913750 GAAGCTGCTGGGAACCCTGGAGG + Intergenic
977688316 4:99874592-99874614 GAAAATGGTGGGAACCCGGGAGG + Intergenic
985767597 5:1788062-1788084 TAAGCTGATGGGGACCCCTGGGG - Intergenic
985823826 5:2178661-2178683 GGAAGTGATGGGCACAGCGGGGG - Intergenic
986337441 5:6766165-6766187 GGAACTGATGGACTCCCCTGGGG - Intergenic
991485203 5:67128325-67128347 GAAAGTGCTGGGCACCCAGCTGG + Intronic
994238476 5:97392798-97392820 GACAATGATGAGCACCCCAGAGG + Intergenic
994751793 5:103747265-103747287 GGAAATGATGGGCAGCACGGAGG - Intergenic
1001260006 5:170220241-170220263 GCATCTGGTGGGTACCCCGGGGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1004454492 6:15779191-15779213 GAGACTGGTGGGAACCCGGGAGG + Intergenic
1009850672 6:69194111-69194133 GAAATTTATGGCCACACCGGAGG - Intronic
1012735321 6:102932282-102932304 GAAACTGATGGGAAACCTGGAGG - Intergenic
1015576752 6:134679906-134679928 GATACTGATGGGCACCTGGGTGG - Intergenic
1018158541 6:161013889-161013911 TAAACTGATTGGCACACTGGTGG + Intronic
1018483870 6:164219760-164219782 TAATCTTATGGTCACCCCGGAGG + Intergenic
1019133832 6:169896243-169896265 GGAACTGATGGGCACAGAGGAGG + Intergenic
1019934257 7:4244080-4244102 GAAACTGAGGCACACCCTGGGGG + Intronic
1034424177 7:151005719-151005741 GAGACTGAAGGGCAGCTCGGTGG - Intronic
1035400045 7:158558801-158558823 GAAGCTGAGTGGCACCCCAGAGG - Intronic
1037496545 8:19446404-19446426 GAAAATGATGAGCTCCCTGGAGG - Intronic
1037939480 8:22940996-22941018 CAAACTGAGGGGCACCCTGGAGG - Intronic
1041551753 8:59110733-59110755 GATATTGATAGGCCCCCCGGGGG - Intronic
1046550206 8:115706519-115706541 GAAATTGTTGGACACCCAGGTGG - Intronic
1050924180 9:11241965-11241987 GAAACTGTGGGGCTCCCTGGGGG + Intergenic
1055120647 9:72656792-72656814 GAAACTTATCTGCATCCCGGAGG - Intronic
1057231172 9:93322406-93322428 GAGAATGATGGGAACCCGGGAGG - Intronic
1058282212 9:103129343-103129365 GAAAATGATGTGAACCCAGGAGG + Intergenic
1058937241 9:109780402-109780424 GAAACTGATGGGCACCCCGGGGG - Exonic
1060890932 9:127187889-127187911 GATTCTGCTGTGCACCCCGGGGG - Intronic
1061809682 9:133155066-133155088 GACCCTGCTGGGCACCCGGGAGG - Intronic
1062287848 9:135781056-135781078 GAAAGAGATGGGCCCCACGGCGG - Intronic
1186834604 X:13425150-13425172 GAGAATGATGTGAACCCCGGAGG + Intergenic
1199311875 X:146330282-146330304 GAGAATGATGGGAACCCAGGAGG - Intergenic
1201603922 Y:15764333-15764355 GAAAATGATGTGAACCCAGGAGG - Intergenic