ID: 1058937940

View in Genome Browser
Species Human (GRCh38)
Location 9:109786298-109786320
Sequence TTCCCAAGGATCCCTCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058937934_1058937940 10 Left 1058937934 9:109786265-109786287 CCTTGCAATGATTTACATACTAT 0: 1
1: 0
2: 0
3: 18
4: 165
Right 1058937940 9:109786298-109786320 TTCCCAAGGATCCCTCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058937940 Original CRISPR TTCCCAAGGATCCCTCAGAG GGG Intronic
No off target data available for this crispr