ID: 1058939494

View in Genome Browser
Species Human (GRCh38)
Location 9:109799853-109799875
Sequence GCTTTCCACTGAAGCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058939494_1058939500 10 Left 1058939494 9:109799853-109799875 CCTCCCCAGCTTCAGTGGAAAGC 0: 1
1: 0
2: 1
3: 13
4: 206
Right 1058939500 9:109799886-109799908 ATGGAAAACCAGTTTCGAGTTGG No data
1058939494_1058939503 20 Left 1058939494 9:109799853-109799875 CCTCCCCAGCTTCAGTGGAAAGC 0: 1
1: 0
2: 1
3: 13
4: 206
Right 1058939503 9:109799896-109799918 AGTTTCGAGTTGGAATGTGGAGG No data
1058939494_1058939504 30 Left 1058939494 9:109799853-109799875 CCTCCCCAGCTTCAGTGGAAAGC 0: 1
1: 0
2: 1
3: 13
4: 206
Right 1058939504 9:109799906-109799928 TGGAATGTGGAGGCTATTTCTGG No data
1058939494_1058939501 17 Left 1058939494 9:109799853-109799875 CCTCCCCAGCTTCAGTGGAAAGC 0: 1
1: 0
2: 1
3: 13
4: 206
Right 1058939501 9:109799893-109799915 ACCAGTTTCGAGTTGGAATGTGG No data
1058939494_1058939498 -9 Left 1058939494 9:109799853-109799875 CCTCCCCAGCTTCAGTGGAAAGC 0: 1
1: 0
2: 1
3: 13
4: 206
Right 1058939498 9:109799867-109799889 GTGGAAAGCCTTAGAGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058939494 Original CRISPR GCTTTCCACTGAAGCTGGGG AGG (reversed) Intronic
901375629 1:8836384-8836406 GCTTTCCACTGATGCGAGGGTGG + Intergenic
903321878 1:22548215-22548237 GGGCGCCACTGAAGCTGGGGAGG - Intergenic
904039106 1:27574207-27574229 GCCTTCCACTGGGGGTGGGGCGG - Intronic
904339799 1:29827457-29827479 GGTTCCCACTGAAGATGGGAAGG + Intergenic
905241139 1:36582337-36582359 ACTTTCCACAGAAGCAGTGGGGG - Intergenic
905873469 1:41417935-41417957 GCTTCCCACTTAGGGTGGGGTGG - Intergenic
907285636 1:53377756-53377778 GCCTTCCATTAAAGCTGGGGAGG + Intergenic
909501617 1:76340767-76340789 GCTTCCCCTGGAAGCTGGGGTGG + Intronic
910139179 1:84007925-84007947 GCTTTCAACTGTAGGTGGAGAGG - Intergenic
910147819 1:84103227-84103249 TCATTCCACTGAATCTGGGCTGG + Intronic
917042582 1:170822448-170822470 GCTTTCCACTAGAGATGGAGGGG - Intergenic
917163960 1:172090680-172090702 GCATTCAACTGAAGGTGGGCAGG - Intronic
917218918 1:172706672-172706694 GGCTTCCACTGAGGCTGGAGGGG - Intergenic
920032586 1:203046170-203046192 GCTCTCTGCTGAGGCTGGGGTGG + Intronic
921503668 1:215939186-215939208 TCTTTCCACTGAAGATGCAGAGG + Intronic
922695283 1:227728334-227728356 GCTTGCCACCGGAGCGGGGGGGG + Intergenic
922879890 1:228972772-228972794 GCCTTCCACTGGAGCTTGAGAGG - Intergenic
924699658 1:246438711-246438733 CTTTTCCACAGATGCTGGGGCGG + Intronic
1063862381 10:10325188-10325210 ACTTTCCAATGAAGCTGGAAAGG + Intergenic
1066623607 10:37383720-37383742 TCTTCCCACTGAGTCTGGGGTGG + Intronic
1067280051 10:44864419-44864441 ACTTACCCCTGCAGCTGGGGTGG - Intergenic
1067510189 10:46888315-46888337 GCCTTCCCCTGCATCTGGGGAGG - Intergenic
1067652065 10:48163549-48163571 GCCTTCCCCTGCATCTGGGGAGG + Exonic
1067851521 10:49757965-49757987 GCTTTCCACTGCAGGTGAAGGGG + Intronic
1071417695 10:85456486-85456508 GCTGTCCAGTGTGGCTGGGGTGG - Intergenic
1073087432 10:100902063-100902085 CCTGTCCACTGAAATTGGGGTGG - Intergenic
1075086634 10:119418292-119418314 GGTCCCCCCTGAAGCTGGGGAGG - Intronic
1075158836 10:120004901-120004923 GTTTCCCACTGGAGCTGGTGGGG + Intergenic
1075698055 10:124450055-124450077 GCTGCCAAGTGAAGCTGGGGAGG + Exonic
1076157795 10:128216687-128216709 GTTTTCCACTGGAGCTGGAAGGG + Intergenic
1076887282 10:133268523-133268545 ACCTTCCCCTGAGGCTGGGGCGG - Intronic
1077371823 11:2185927-2185949 GCGTTCAGCTGGAGCTGGGGTGG + Intergenic
1078327013 11:10389123-10389145 GCCTTTCTCTGAAGCTGGAGAGG + Intronic
1078940245 11:15995255-15995277 GCTTTCCACTGAAACTCCAGAGG + Intronic
1079029972 11:16979376-16979398 GCTTTGCTCTGAAGGTGGTGGGG - Intronic
1079452548 11:20609807-20609829 GCTTTCCTCTGGGGCTGGAGTGG - Intronic
1081834679 11:46143850-46143872 GCTTTCCCCTGGAAGTGGGGTGG - Intergenic
1081946272 11:46997586-46997608 GCTTTCCTCTGTTGCTGGCGAGG + Intronic
1083297074 11:61720579-61720601 TCCTTCCACTGAATCTGGGCTGG + Intronic
1083738242 11:64694016-64694038 CCTTCCCACTAAGGCTGGGGAGG - Intronic
1083861777 11:65423818-65423840 CCTTCCCGCTGAGGCTGGGGTGG + Intergenic
1084091750 11:66883289-66883311 GCTTTCCAGTGAGGCTGGGATGG - Intronic
1087905845 11:103696179-103696201 AGTTGTCACTGAAGCTGGGGAGG - Intergenic
1088897350 11:114088639-114088661 GTGTTCCTCTGAAGCAGGGGTGG + Intronic
1090189995 11:124761297-124761319 GGCTTCAGCTGAAGCTGGGGTGG - Intronic
1090284669 11:125489426-125489448 GCTCTCGACTGAAGCAGGAGAGG + Intronic
1090347118 11:126080465-126080487 CCTCTCCCCTGGAGCTGGGGTGG - Intergenic
1091192936 11:133709255-133709277 AATCTCCACTGAAGGTGGGGAGG - Intergenic
1097353256 12:58572264-58572286 CCCATCCCCTGAAGCTGGGGTGG - Intronic
1100430762 12:94530116-94530138 GCTTTCCCCTGTAGCTTTGGGGG + Intergenic
1101838833 12:108313271-108313293 GTTTTCCATGGAAGGTGGGGTGG - Intronic
1101900527 12:108788462-108788484 TCCTTCCAATGAAGCGGGGGCGG + Exonic
1101989632 12:109474253-109474275 CATTACCAATGAAGCTGGGGAGG + Intronic
1102174283 12:110864764-110864786 TCTATCCCCTGGAGCTGGGGTGG + Intronic
1103272368 12:119684072-119684094 GCTGTTTCCTGAAGCTGGGGAGG - Intergenic
1103915950 12:124375865-124375887 GCTTTCCACTGCCCCCGGGGAGG + Intronic
1105281065 13:18962860-18962882 CCCTTCCATGGAAGCTGGGGTGG - Intergenic
1106124619 13:26890151-26890173 CATTTCCACAGAACCTGGGGTGG - Intergenic
1106228997 13:27807409-27807431 GCTGTCCACAGCAGATGGGGTGG - Intergenic
1106437082 13:29732633-29732655 CCTCTCCACTGAAGCTGTGCGGG + Intergenic
1106845837 13:33736932-33736954 GGTTGCCACTGCTGCTGGGGTGG - Intergenic
1111828178 13:93295249-93295271 CCATTGCACAGAAGCTGGGGTGG + Intronic
1113789699 13:113021844-113021866 GCTTTGCATTGAGGCTGTGGTGG + Intronic
1114647529 14:24263878-24263900 CCTTTCCACTCAGGCTTGGGTGG + Intronic
1118044358 14:61950487-61950509 GCTGTGCACTGAAGCATGGGAGG - Intergenic
1119545537 14:75469003-75469025 GGTGGTCACTGAAGCTGGGGTGG + Intronic
1120187269 14:81406687-81406709 TCTTTCCACTGTGGCTGGGCTGG + Intronic
1122385264 14:101340865-101340887 GCTGTCCACTCACACTGGGGAGG - Intergenic
1122404660 14:101492948-101492970 GCTTCCCAGGGAGGCTGGGGTGG - Intergenic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1124345153 15:28917322-28917344 GGTTTCTCCTGAAGCTGGTGAGG - Intronic
1124615494 15:31238948-31238970 GCTTTCCCCAGAAGCTGGCCTGG - Intergenic
1124855920 15:33388820-33388842 GCTTCAGAGTGAAGCTGGGGAGG + Intronic
1125021328 15:34989564-34989586 GCTTCCAACAGAAGCAGGGGTGG + Intergenic
1125172404 15:36780513-36780535 GCTTTCAAGAGAAGGTGGGGTGG - Intronic
1126969229 15:54091043-54091065 ACCTTCCACAGAAGCTGGGCGGG + Intronic
1127707042 15:61557560-61557582 GCTTTCCACCGAAGACAGGGAGG + Intergenic
1128457479 15:67840365-67840387 TCTTTCCACTGGGGCCGGGGCGG + Intergenic
1130035919 15:80361404-80361426 GCTTTCCACTCCTGCTGTGGTGG + Intronic
1140905044 16:79402616-79402638 CCTTTCCCCTGGAGCTGGGCTGG - Intergenic
1141030410 16:80582874-80582896 TCTTTACTCTGCAGCTGGGGTGG - Intergenic
1141558852 16:84853668-84853690 GCTTTCCAGGGAAGATGGGGAGG - Intronic
1142289088 16:89184502-89184524 GCTTCCCACAGCAGGTGGGGCGG + Intronic
1144050205 17:11491558-11491580 TCTTTCCACAGATGCTTGGGTGG - Intronic
1144834134 17:18148141-18148163 GCTGTCCACTCGAGCTGGGTCGG - Exonic
1145273570 17:21417356-21417378 GCTTTCTACTGTCGTTGGGGTGG + Exonic
1145760421 17:27422397-27422419 GCTTGTTTCTGAAGCTGGGGAGG - Intergenic
1145782529 17:27572427-27572449 TCTTTAGACAGAAGCTGGGGTGG + Intronic
1146883451 17:36456179-36456201 GCTTGTTACTGAAGCCGGGGAGG + Intergenic
1147342868 17:39765141-39765163 GCTTTTCACTGGAGATGGGAAGG + Exonic
1148152755 17:45405850-45405872 GCTGTCCACCGAGGCAGGGGAGG + Exonic
1150207352 17:63419115-63419137 TCTTTCCCATGCAGCTGGGGAGG - Intronic
1152134185 17:78494381-78494403 TCTCTCAACTGAGGCTGGGGGGG - Intronic
1152631854 17:81414063-81414085 ACTCTCCTCTGAAGCTGTGGGGG + Intronic
1152987898 18:336185-336207 GCTGTCCACCAAAGCTGTGGGGG + Intronic
1154183395 18:12157774-12157796 GGTTTCCACTGCAGCTGGAAAGG + Intergenic
1155534749 18:26805576-26805598 GCATTCCCCTGAAGCTGGATTGG + Intergenic
1158687130 18:59624782-59624804 GGTAAACACTGAAGCTGGGGAGG - Intronic
1159128946 18:64257932-64257954 ACTTTCCAAGGTAGCTGGGGAGG + Intergenic
1159942934 18:74422473-74422495 GCTGTTCAATCAAGCTGGGGAGG + Intergenic
1160021346 18:75184217-75184239 GCCTTCCAGTGACGATGGGGAGG - Intergenic
1160572826 18:79830584-79830606 GCTGGCCTCTGGAGCTGGGGCGG - Intergenic
1161204833 19:3035610-3035632 AATTTCCACAGTAGCTGGGGCGG - Intronic
1162353179 19:10163969-10163991 CCTGTCCTCTGAACCTGGGGAGG - Intronic
1162353635 19:10166775-10166797 CCTGTCCTCTGAACCTGGGGAGG - Intronic
1162540651 19:11293977-11293999 GCTTTGCAGAGAAGCTGGGAGGG + Intergenic
1163008184 19:14409257-14409279 GCTTTCCCCTGGCGGTGGGGTGG - Intronic
1165765930 19:38351214-38351236 ACTTTCCAATGAGGCTGAGGCGG + Intronic
1166478572 19:43150822-43150844 GCTGGCCACTGAGGCTGGTGTGG + Intronic
1166851366 19:45763071-45763093 GTTTTCCACTGTGGCTTGGGGGG - Intronic
1167491623 19:49795841-49795863 GGATTTCTCTGAAGCTGGGGCGG + Intronic
926091377 2:10052235-10052257 CCTTTCAACTGCAGCTGGGATGG + Exonic
927359995 2:22222017-22222039 TCTTTCCTCTGAATCTGTGGTGG - Intergenic
928994979 2:37279548-37279570 GCCATCCACTCAAGATGGGGAGG - Intronic
929553327 2:42907920-42907942 CCTTTGGACTGAAGATGGGGAGG - Intergenic
932804254 2:74769245-74769267 GCTTTCCAGGAAAGCTGGGGAGG + Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
933564607 2:83934806-83934828 GCTCTCCACTCAGGCTGGTGTGG + Intergenic
933779636 2:85792479-85792501 GCTTCCCACTGAACATGGCGTGG - Intergenic
933990048 2:87627622-87627644 GCATTCCAGTGATGCAGGGGAGG + Intergenic
934718573 2:96557433-96557455 TCTTTCCACAGCAGCTGGAGAGG + Intergenic
936303798 2:111323202-111323224 GCATTCCAGTGATGCAGGGGAGG - Intergenic
936542327 2:113362339-113362361 GCTTTCCCCTAGAACTGGGGAGG - Intergenic
937921778 2:127136488-127136510 GCTGGCCCCTGATGCTGGGGTGG + Intergenic
938422365 2:131155324-131155346 GCTTTCCACTGAAACGTGGCAGG - Intronic
939690991 2:145260254-145260276 GCTTTTAGCTGAAGCTGGTGAGG - Intergenic
940640807 2:156342559-156342581 GCTTTCCAGTGACGCTGGGGCGG + Intergenic
940905225 2:159163185-159163207 ACTTTCCATTGATCCTGGGGAGG + Intronic
941448884 2:165635019-165635041 GACTTACACTGCAGCTGGGGAGG + Intronic
947466059 2:230347573-230347595 GCTGGCCACTGAGGCTGGGCAGG + Intronic
947647970 2:231758640-231758662 TCATTCCACTGAAGCCAGGGTGG + Intronic
1170988561 20:21280993-21281015 GCTTTGCACTGAAGCAAGGCTGG + Intergenic
1171177182 20:23061330-23061352 GCTTTACTCTGAAGTAGGGGCGG + Intergenic
1171370802 20:24661005-24661027 GCTTTTCACTCAGGCTGTGGGGG - Intronic
1172149679 20:32780880-32780902 GCTTTCCAACCCAGCTGGGGCGG - Intronic
1172577538 20:36020858-36020880 CCTTTCCTCTGAAGCTGCTGAGG - Intronic
1173301867 20:41810541-41810563 GGTCTCCACTGAAACTGTGGAGG - Intergenic
1174352996 20:49981718-49981740 GCCTCCCAGGGAAGCTGGGGTGG + Intergenic
1175170881 20:57080658-57080680 GCTTCCCATTGAAGCTGGTAGGG + Intergenic
1175949412 20:62575279-62575301 GCTTTCCAAGGAAGGTGGGCAGG + Intergenic
1176043910 20:63082683-63082705 ACTGTCCACCGACGCTGGGGAGG - Intergenic
1176046371 20:63094862-63094884 GCATCCCAAGGAAGCTGGGGGGG + Intergenic
1178436832 21:32567408-32567430 GCTCTGCACTCAAGTTGGGGAGG - Intergenic
1178500628 21:33123208-33123230 GCATTGCACAGAGGCTGGGGAGG - Intergenic
949863107 3:8524304-8524326 GCTTCCACCTGAAGTTGGGGAGG + Intronic
950974698 3:17228145-17228167 GCCTTCAACTGAGGCTGTGGTGG + Intronic
953578017 3:44128735-44128757 GCTTTCCACAGCAGCTAAGGAGG + Intergenic
954415641 3:50391987-50392009 GCTTTGCACTGAAGGAGGGGTGG + Intronic
959743658 3:109750893-109750915 GCTTGCCAGTGCAGCTGCGGGGG + Intergenic
960951884 3:123004627-123004649 GCTCTCCAGAGAAGCTGGGGTGG - Intronic
964089018 3:152851048-152851070 GCTTTCCACTGATGCTGAAAAGG - Intergenic
966038294 3:175447702-175447724 GCTATCCACTGAATCTTGGCAGG - Intronic
968759129 4:2433040-2433062 CCTTGCCACTGATGCTGGGCTGG - Intronic
970287445 4:14533709-14533731 GCCTTCTACTAAAGCTGGGAAGG + Intergenic
972396309 4:38662847-38662869 GCCATACACTGAAGCAGGGGCGG + Intergenic
975404735 4:73976523-73976545 GCTTGCCACTGAAGAGGGTGAGG + Intergenic
975983909 4:80185959-80185981 GCTGTCCACCGAAGCTGGCGGGG + Intronic
980639117 4:135551710-135551732 GCTGTTCACAGAAGCTGGAGAGG + Intergenic
981868871 4:149462238-149462260 GCTTTCCACTGAGTGTGCGGTGG - Intergenic
987242125 5:16010908-16010930 GTTTTCATCTGAAACTGGGGTGG + Intergenic
990811409 5:59728492-59728514 GCTTTCAACTGAATATGGTGGGG + Intronic
995350354 5:111167866-111167888 GGTTTCCACTGAAACTCGAGTGG + Intergenic
997586308 5:135045672-135045694 GGTTTACCCTGAAGCTGGGATGG + Intronic
998560011 5:143162642-143162664 GCGTTCCACTGAGGCTGAAGGGG - Intronic
999293593 5:150443877-150443899 GCTTTGCACAGAAGGTGTGGGGG + Exonic
999534343 5:152500985-152501007 GCTTTCCACTGATGCTCTGACGG - Intergenic
1000255017 5:159529347-159529369 GCTTCCCCTTGAATCTGGGGTGG - Intergenic
1000345873 5:160312711-160312733 GCTTTCCGCCGAAGCGAGGGAGG - Intronic
1000352543 5:160363239-160363261 GCTTTTCAGAGAAGCTGGAGAGG - Intronic
1006820457 6:36889406-36889428 GCTTTCCTCTGAAGGGAGGGAGG + Intronic
1006916033 6:37594461-37594483 GCTTTCCATTGGAGCTGGAAGGG - Intergenic
1008843017 6:55927489-55927511 ATTTTCCTCTGAAGCTGGGTTGG - Intergenic
1009925762 6:70118872-70118894 GCTTACCACTGGGGGTGGGGTGG - Intronic
1011778590 6:90760944-90760966 GCTGCCCTCTGAAGGTGGGGCGG - Intergenic
1013202321 6:107911202-107911224 TCTTGCCACTGAAGGTGAGGTGG - Intronic
1015036901 6:128667208-128667230 GTTTTCCAAAGAAGGTGGGGAGG - Intergenic
1016394265 6:143605525-143605547 CCCTTCCTCTGATGCTGGGGAGG + Intronic
1018423790 6:163662634-163662656 GCTTTCCACGGGAGCAGAGGAGG - Intergenic
1019229362 6:170545581-170545603 GCTATCAACTGAAGCTGGTCAGG + Intronic
1020002441 7:4763556-4763578 GCTCACCACTGCTGCTGGGGTGG - Exonic
1020270759 7:6593973-6593995 GGCTTACACTGAAGCAGGGGTGG - Intronic
1021850996 7:24808534-24808556 GCTTGCCTCTGAAGCTAGGAAGG + Intronic
1021913263 7:25407227-25407249 GCTTTGCAGTGTGGCTGGGGAGG - Intergenic
1022028678 7:26471643-26471665 GCTTTCCAGTGCTGCTGTGGTGG - Intergenic
1024700828 7:51902179-51902201 GTTTTCATCTGAAGCTGGGCAGG + Intergenic
1028106933 7:86889407-86889429 GGCATCCACTGGAGCTGGGGGGG - Intronic
1031756238 7:125646424-125646446 GCTCTCCGGTGAAGCTGAGGAGG + Intergenic
1032547581 7:132756482-132756504 GCTTTACACTGAATCTCTGGCGG - Intergenic
1033246085 7:139717357-139717379 GCTTTCTACTGAAACTCAGGAGG + Intronic
1033253148 7:139777684-139777706 GATTCCGACTGAGGCTGGGGGGG - Exonic
1033605653 7:142926476-142926498 CTTTTCTACTGAAGCTGGAGGGG + Intronic
1035616991 8:1009228-1009250 GCATTCCACTGAAGGAGGGGAGG - Intergenic
1035793638 8:2332431-2332453 GGTTTCCACTGAAACCTGGGAGG + Intergenic
1035799165 8:2389274-2389296 GGTTTCCACTGAAACCTGGGAGG - Intergenic
1036509510 8:9387421-9387443 GGCTTCCACTAAAGGTGGGGAGG + Intergenic
1038076046 8:24076239-24076261 GCTTTCCATTGTAGCTGTTGAGG + Intergenic
1040601015 8:48883849-48883871 GTTTTCCACTGGAGCTTGGCTGG + Intergenic
1041747691 8:61226727-61226749 TCTTAACACTGAGGCTGGGGAGG + Intronic
1042574824 8:70206048-70206070 ACTCTTCACTAAAGCTGGGGTGG + Intronic
1044369783 8:91395849-91395871 GTTTTCCACTGAAGCTTTGTTGG + Intronic
1045062099 8:98419419-98419441 CGTTCCCACTGAAGCTGGAGGGG - Intronic
1045901898 8:107291876-107291898 TATTTCCACTGAAGATGGGGGGG + Intronic
1049592606 8:143469402-143469424 GCTGCCCACTGCAGCTGTGGAGG + Intronic
1050380212 9:5020502-5020524 GCTGTGCCCTGATGCTGGGGAGG + Intronic
1051182462 9:14425632-14425654 GCTATCCACTGAAGCTTAGATGG + Intergenic
1051679637 9:19594131-19594153 GCTTTCCATGGAAGTTGGGCGGG - Intronic
1055580930 9:77705623-77705645 GCTTTCCACTGAACTTGTGAGGG + Intergenic
1057489731 9:95511366-95511388 GCCTCCCCCTGAAGCCGGGGAGG - Intronic
1058939494 9:109799853-109799875 GCTTTCCACTGAAGCTGGGGAGG - Intronic
1059315645 9:113423538-113423560 GCTTTTTACTGAAGCTGGGATGG + Intronic
1060498852 9:124137691-124137713 AATTTCGACTGCAGCTGGGGCGG + Intergenic
1060540023 9:124423051-124423073 GCATTCCATGGAGGCTGGGGTGG - Intergenic
1061509380 9:131051105-131051127 GCTGTCCACCAAAGCTGTGGCGG + Intronic
1062138324 9:134941576-134941598 GCTGTTCCCTGCAGCTGGGGTGG - Intergenic
1185840966 X:3390935-3390957 CTTTTCCACTGACACTGGGGAGG - Intergenic
1186876820 X:13825610-13825632 GCTTTGCACTGATGCTGGCAAGG - Intronic
1192230290 X:69259953-69259975 GGTCTCAACTGAAGCAGGGGTGG - Intergenic
1193580068 X:83252975-83252997 GCTTGCCAGAGAAGCTGAGGTGG + Intergenic
1193952225 X:87813779-87813801 TGTGTCCACAGAAGCTGGGGGGG + Intergenic
1200146997 X:153931506-153931528 GCTTGCAAGTGAAGCTGGGGTGG - Intronic
1201400939 Y:13603101-13603123 GCCCACCACTGGAGCTGGGGAGG + Intergenic