ID: 1058939495

View in Genome Browser
Species Human (GRCh38)
Location 9:109799856-109799878
Sequence AAGGCTTTCCACTGAAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058939495_1058939500 7 Left 1058939495 9:109799856-109799878 CCCCAGCTTCAGTGGAAAGCCTT 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1058939500 9:109799886-109799908 ATGGAAAACCAGTTTCGAGTTGG No data
1058939495_1058939501 14 Left 1058939495 9:109799856-109799878 CCCCAGCTTCAGTGGAAAGCCTT 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1058939501 9:109799893-109799915 ACCAGTTTCGAGTTGGAATGTGG No data
1058939495_1058939504 27 Left 1058939495 9:109799856-109799878 CCCCAGCTTCAGTGGAAAGCCTT 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1058939504 9:109799906-109799928 TGGAATGTGGAGGCTATTTCTGG No data
1058939495_1058939503 17 Left 1058939495 9:109799856-109799878 CCCCAGCTTCAGTGGAAAGCCTT 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1058939503 9:109799896-109799918 AGTTTCGAGTTGGAATGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058939495 Original CRISPR AAGGCTTTCCACTGAAGCTG GGG (reversed) Intronic
900647179 1:3714285-3714307 AAGGCTGTCCCAGGAAGCTGTGG + Intronic
903473275 1:23602182-23602204 AAGTTATTCCACTGAGGCTGGGG - Intronic
905241142 1:36582340-36582362 AACACTTTCCACAGAAGCAGTGG - Intergenic
906552095 1:46673417-46673439 AAGGCTTGGCATTGAAGCTATGG - Exonic
907068553 1:51512014-51512036 AAGGCTTTCAAATGAATCAGAGG - Intronic
908298341 1:62736051-62736073 AAGTTTTTAAACTGAAGCTGAGG - Intergenic
908456394 1:64308735-64308757 ATGGCTTTGCTCTGAAGCTCTGG + Intergenic
908864445 1:68530845-68530867 AAAGCTTTCCATTGAGGCAGTGG - Intergenic
909501616 1:76340764-76340786 AAGGCTTCCCCTGGAAGCTGGGG + Intronic
911666928 1:100564022-100564044 AAGACTTTCTAATGAACCTGGGG - Intergenic
912785190 1:112595949-112595971 ATGGCTATCTACTGAAGTTGTGG - Intronic
914665890 1:149832354-149832376 AAGGCATTGCACTGAGGCTAAGG - Intergenic
914669875 1:149861440-149861462 AAGGCATTGCACTGAGGCTAAGG + Intronic
917564700 1:176201316-176201338 AAGCCTTTCCTCCCAAGCTGTGG + Intronic
919781667 1:201225227-201225249 AAGGCTTTCCTCCCCAGCTGTGG + Intronic
921169306 1:212532262-212532284 AAGGAGATCCACTGAGGCTGAGG - Intergenic
921619500 1:217310470-217310492 AAGGCTGTCCACTTAAAGTGAGG + Intergenic
921859980 1:220032378-220032400 AAGGCTTACCACTCGAGCTTTGG + Exonic
923411798 1:233717894-233717916 AAGGCTGTTGGCTGAAGCTGTGG + Intergenic
924323867 1:242876013-242876035 AAGGATCTCCAGTGAGGCTGTGG + Intergenic
1065720788 10:28627069-28627091 AAGCCTTTCCACTGATGCCTTGG + Intergenic
1068844648 10:61658504-61658526 AAGCCTTTCCATAGACGCTGGGG - Intergenic
1069143304 10:64856191-64856213 AAGGCTTTCCACTGCCCTTGAGG + Intergenic
1070587748 10:77779676-77779698 AAAGCCTTCAACTGCAGCTGAGG + Intergenic
1071229028 10:83564009-83564031 AAGGCCTTCAACTCAAGATGTGG + Intergenic
1071384462 10:85105468-85105490 AAACCTTTCTTCTGAAGCTGAGG - Intergenic
1074077167 10:110139542-110139564 AAGTCTTTATACTGAAGCTGTGG + Intergenic
1079682232 11:23312224-23312246 AAGGCTGTCATCTGAAGTTGTGG + Intergenic
1080759022 11:35229767-35229789 ATTGCTTTCCACTGAGGTTGGGG + Exonic
1088093514 11:106072484-106072506 AAGGTGTTTCATTGAAGCTGGGG - Intronic
1088988494 11:114929865-114929887 AAAGCCTTCAACTGCAGCTGAGG - Intergenic
1089078049 11:115754516-115754538 TAGACCTTCCACTGAAGATGGGG + Intergenic
1090570229 11:128037472-128037494 AAGCATTGCCAGTGAAGCTGGGG + Intergenic
1090669331 11:128935111-128935133 ATGACTGTCCACTGCAGCTGGGG + Intronic
1091623694 12:2107079-2107101 GAGGGTTTCCACTTCAGCTGGGG + Intronic
1091672196 12:2460141-2460163 AAGGCCTACCACCGAAGGTGAGG - Intronic
1092064383 12:5577895-5577917 AAGGGCTTCCAGAGAAGCTGAGG - Intronic
1092757062 12:11773796-11773818 AAGGCGGTCCTCTGAAGCTGAGG + Intronic
1095554432 12:43483469-43483491 AAGGCTGTCCACAGATGGTGAGG - Intronic
1095640201 12:44478361-44478383 AAGTCTTTCCATAAAAGCTGCGG - Intergenic
1095933431 12:47651967-47651989 TAGGTTTTCCTGTGAAGCTGGGG - Intergenic
1096113710 12:49043070-49043092 CAGGATTTCCACAGAAGGTGAGG - Exonic
1098820411 12:75220932-75220954 AAAGCCTTCAACTGCAGCTGAGG + Intergenic
1100195802 12:92243029-92243051 AAGGCTTTCTGCCAAAGCTGTGG + Intergenic
1101414400 12:104496873-104496895 AAAACTTTCCACTGGAGGTGGGG + Intronic
1101601787 12:106215937-106215959 CAGTCTTTCCACTGAGCCTGGGG - Intergenic
1103156953 12:118693692-118693714 AAGGCTTTGCCCTGAAGTTGAGG - Intergenic
1107559733 13:41548135-41548157 AAGCCCTTGCACTGTAGCTGAGG + Intergenic
1109206320 13:59486898-59486920 AATGCCTTCCACTGAAGCAGTGG + Intergenic
1112471076 13:99690115-99690137 AAAACTTTCCACTGGGGCTGGGG - Intronic
1113608194 13:111625108-111625130 AACAGTTTCCGCTGAAGCTGAGG + Intronic
1113806570 13:113113600-113113622 CAGACTTTCCTCTGGAGCTGAGG - Intronic
1114278786 14:21170653-21170675 CAGGCTTCCCACTGCAGCTCTGG - Intergenic
1117376547 14:55123166-55123188 AAGTCTTTCCTGGGAAGCTGGGG - Intergenic
1117540521 14:56742494-56742516 AATGCTTTCCTCTGAAGGAGGGG + Intergenic
1119687277 14:76642982-76643004 GAGGCTTTACCCTGAATCTGTGG - Intergenic
1121323119 14:93004262-93004284 AAAGCTGTCCTCTGAGGCTGCGG + Intronic
1121464058 14:94102835-94102857 CAGGCTTTCCACTCATTCTGTGG + Intronic
1122939943 14:104976796-104976818 AAGGCTGTGCAGGGAAGCTGGGG + Intronic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1124594402 15:31081240-31081262 ACGGATTTCCAGTGAAGCAGAGG - Intronic
1128797194 15:70474564-70474586 AGGACTTTCCACTGTGGCTGGGG - Intergenic
1130200946 15:81826332-81826354 AAGGCTTTCCCCAGCAACTGAGG + Intergenic
1130782226 15:87053247-87053269 AAGGATTTCCACTAAAACTGTGG + Intergenic
1131341188 15:91602639-91602661 AAACCTTCTCACTGAAGCTGGGG + Intergenic
1131440546 15:92456289-92456311 AAGGGCTTGCAGTGAAGCTGGGG + Intronic
1133916511 16:10113506-10113528 AAAGCCTTCAACTGCAGCTGAGG - Intronic
1135500190 16:22989573-22989595 AAGCCCCTTCACTGAAGCTGGGG + Intergenic
1138742668 16:59328966-59328988 ATTGCTTTCATCTGAAGCTGCGG + Intergenic
1141278902 16:82613047-82613069 AGGGCTTTCTTCTGAAGCTGTGG - Intergenic
1141877994 16:86839490-86839512 AAGGTTATCCACTTAAGCAGTGG + Intergenic
1148202943 17:45761995-45762017 AAGGATTTCCAGAGAGGCTGAGG + Intergenic
1148705634 17:49628779-49628801 AATGCTTTCAACTGAACCTACGG + Intronic
1148737330 17:49872244-49872266 AAGCCTTTTCCCTGAAGCTCAGG + Intergenic
1150446661 17:65231838-65231860 AGGGCTGACCTCTGAAGCTGGGG - Intergenic
1150990335 17:70250493-70250515 AAGTCTTCCTACTGAAGGTGTGG + Intergenic
1151513828 17:74579528-74579550 GAGGCTGTTCCCTGAAGCTGGGG + Exonic
1152036326 17:77875269-77875291 GTGGCTTTCCAATTAAGCTGGGG + Intergenic
1152631851 17:81414060-81414082 TAGACTCTCCTCTGAAGCTGTGG + Intronic
1154323467 18:13372692-13372714 AAGACATTGCACTGAAGATGAGG + Intronic
1154935248 18:21048185-21048207 TAGGCCTTTCTCTGAAGCTGTGG - Intronic
1155718362 18:28975772-28975794 AAGGGTTTCCACTCTGGCTGTGG - Intergenic
1158013135 18:52751953-52751975 AAAGCTTTTCACAAAAGCTGAGG - Intronic
1159915143 18:74182092-74182114 AAGGCCTTCAAGTGAGGCTGCGG - Intergenic
926430685 2:12782780-12782802 AAGGCTTCCCAAGGAAGCGGGGG + Intergenic
927237781 2:20891293-20891315 AAAACTTTCCACTGAAGATCGGG - Intergenic
928144523 2:28760045-28760067 AAGACCTTCCAGTGAAGATGTGG + Intronic
929618211 2:43328845-43328867 AAGGCATGGCATTGAAGCTGTGG - Intronic
930006219 2:46899197-46899219 TAGGCTTTTTCCTGAAGCTGAGG + Intergenic
930561259 2:52962329-52962351 AGGACTTTCCACTGAAGAAGTGG - Intergenic
930776410 2:55175970-55175992 AAGACTTTCTACTGCATCTGTGG + Exonic
933103693 2:78293580-78293602 AAGGGATTCCACTAAAGCTGTGG + Intergenic
933863468 2:86494214-86494236 AAAGCTTTCCCCTAAAGATGAGG - Intergenic
934756634 2:96828789-96828811 AAGGCCTTCCACTCATCCTGAGG + Intronic
935387834 2:102519883-102519905 AAGACTTTCCCCTGAAGATGTGG + Exonic
935480225 2:103578410-103578432 AAAGCTTTCCCCTTAAGATGGGG - Intergenic
935695095 2:105764332-105764354 AAGCATTTCCACTCGAGCTGTGG - Intronic
936145723 2:109979579-109979601 CAGGCCTTCCACAGGAGCTGTGG - Intergenic
936198966 2:110391899-110391921 CAGGCCTTCCACAGGAGCTGTGG + Intergenic
938086913 2:128407766-128407788 AAGCCTGTCCTCTGAGGCTGTGG + Intergenic
938486773 2:131719690-131719712 AAGGCTTTCCAGTGACACTGTGG + Intergenic
939088505 2:137750597-137750619 TAGCCTTTCCACTTTAGCTGAGG - Intergenic
939851048 2:147305263-147305285 AAAGCTTTCCCATGAAGCTTTGG - Intergenic
940094307 2:149956734-149956756 AAGGAATTGCACTGGAGCTGTGG + Intergenic
940640806 2:156342556-156342578 GCGGCTTTCCAGTGACGCTGGGG + Intergenic
941136930 2:161729110-161729132 AATGCTTTCCACATAAGATGAGG + Intronic
942256625 2:174108221-174108243 AAGGCTTTCCAATGTTGCTAGGG + Intronic
944581494 2:201136877-201136899 AAAGCCTTCAACTGCAGCTGAGG + Intronic
947647969 2:231758637-231758659 AAGTCATTCCACTGAAGCCAGGG + Intronic
948628528 2:239285417-239285439 AAGGGGTTCCACCGAGGCTGGGG + Intronic
1169398180 20:5254487-5254509 AGTGCTTTCCATTGACGCTGTGG - Intergenic
1169446652 20:5677400-5677422 AAGACTTGCCACTGTAGCAGAGG + Intergenic
1170686722 20:18576085-18576107 AAGGGTTTCCATTGAATCCGGGG + Intronic
1173359988 20:42334556-42334578 AAGCCATTTCAGTGAAGCTGTGG + Intronic
1173770241 20:45650022-45650044 AAGCCTTGCCACTGAAACTAAGG + Intronic
1175829503 20:61954377-61954399 AAGGGGTCCCACTGCAGCTGGGG + Intronic
1175845394 20:62055715-62055737 AAGGCTTTCCCAGGAGGCTGAGG - Intronic
1180856496 22:19049253-19049275 AAGGCAGTCCACTGGACCTGAGG + Intronic
1183027121 22:35073642-35073664 AATGCTTCCCAGAGAAGCTGTGG + Intronic
1184200729 22:42967473-42967495 AAGGCTTTTCATTGATTCTGGGG - Intronic
1185027073 22:48420791-48420813 AAAGGTTTCCTCTGCAGCTGTGG - Intergenic
1185141354 22:49103376-49103398 AACGCTTTCCACTCAAAATGTGG - Intergenic
950121885 3:10487433-10487455 TAGGATCTCCACTGAGGCTGTGG + Intronic
950974697 3:17228142-17228164 ATGGCCTTCAACTGAGGCTGTGG + Intronic
952970352 3:38646895-38646917 AAGTCTTTCCATTGAAGGAGAGG - Intronic
954415640 3:50391984-50392006 GAGGCTTTGCACTGAAGGAGGGG + Intronic
954715942 3:52526989-52527011 AATACTCTCTACTGAAGCTGTGG - Intronic
957778272 3:84784851-84784873 AAGCCTTTCCTCTGTAGTTGGGG + Intergenic
959743655 3:109750890-109750912 TAGGCTTGCCAGTGCAGCTGCGG + Intergenic
965598349 3:170430326-170430348 AAGACTTTCCCCTGCATCTGAGG + Intronic
967253383 3:187565675-187565697 TATTCTTCCCACTGAAGCTGGGG - Intergenic
968967299 4:3775597-3775619 ATGGCTCTGCACAGAAGCTGTGG - Intergenic
970433691 4:16012504-16012526 TAGTCTGTCCACTGATGCTGAGG - Intronic
972687146 4:41361852-41361874 AAGGCCACCCATTGAAGCTGAGG - Intronic
979957179 4:126968380-126968402 AAGGCTGTAAACTGAAGCTCAGG + Intergenic
983341957 4:166472131-166472153 AAGCCTTTCCACTTAAGATCAGG + Intergenic
983346939 4:166538832-166538854 ATGGCTTTCCCCTGAAGATCAGG + Intergenic
986411682 5:7487550-7487572 AAAGCTTTCCACTGTGGGTGAGG + Intronic
988315802 5:29626013-29626035 AAGGCTTTACACTGAAGGCATGG + Intergenic
991725646 5:69533198-69533220 AAGGCTTACCACAGAACCTTTGG - Intronic
992296991 5:75335727-75335749 AAGGTCTTACACTGAAGCAGTGG + Intergenic
994088721 5:95788818-95788840 CAGGCTTTTGACTGAAGATGAGG - Exonic
995084509 5:108091805-108091827 AATGCATTTCACTGAAACTGAGG + Intronic
996000305 5:118353611-118353633 AAGGCTTCCCACTGGTGCTGAGG - Intergenic
998314154 5:141165061-141165083 CAGGCTTTGATCTGAAGCTGTGG - Intergenic
998799818 5:145857711-145857733 AAGGCTCTTTACAGAAGCTGAGG + Intergenic
998938704 5:147257565-147257587 AGGGCTTTCCCCTGGGGCTGTGG + Intronic
1000715976 5:164644815-164644837 AAGGCTTTTCTCTGAAGATTGGG + Intergenic
1001712884 5:173792231-173792253 AAGGCCTTACACTGAATGTGGGG + Intergenic
1001789903 5:174447140-174447162 GAGGCTTTCCACAAATGCTGAGG - Intergenic
1001809275 5:174614915-174614937 CAGGCTTTCCCCTGGAGCTAGGG - Intergenic
1002846558 6:950976-950998 AAGACTTACCTCTCAAGCTGGGG - Intergenic
1004170391 6:13291426-13291448 AAGGCTTTCAGCGGAAGCAGAGG + Intronic
1004731713 6:18366089-18366111 AAAGCCTTCAACTGCAGCTGAGG + Intergenic
1004810358 6:19253412-19253434 AATGCTTTTCACTGAAACTAGGG - Intergenic
1006618160 6:35343457-35343479 AAGGCTTCTCCCTGAAGCAGGGG - Intronic
1010089072 6:71958283-71958305 AGGGTTTCCCAGTGAAGCTGTGG + Intronic
1010602533 6:77848322-77848344 AAGGCTTTCCAGTGAAGAAATGG - Intronic
1011037297 6:82991595-82991617 GAGGATTTACACTTAAGCTGTGG - Intronic
1013202322 6:107911205-107911227 GAGTCTTGCCACTGAAGGTGAGG - Intronic
1015086734 6:129303489-129303511 AATGCTTTCCACTTAAACTAAGG - Intronic
1018423791 6:163662637-163662659 TAGGCTTTCCACGGGAGCAGAGG - Intergenic
1018582182 6:165316974-165316996 AAGCGTTTCCATTGAGGCTGAGG + Intergenic
1018779971 6:167054439-167054461 AAGGCTTTCCACTGTTTCTTAGG - Intergenic
1019120421 6:169799537-169799559 ACCTCCTTCCACTGAAGCTGCGG + Intergenic
1020103281 7:5407436-5407458 ATGGCTTTCCGCTGGAGCGGAGG - Intronic
1020254260 7:6493577-6493599 AGGGCTTTGCACTGACTCTGGGG + Intergenic
1022960332 7:35419820-35419842 TGGGCTTTCCAATGAGGCTGGGG + Intergenic
1023508176 7:40921829-40921851 AAGGCTCTAGACTGGAGCTGAGG + Intergenic
1026152086 7:67796460-67796482 GAAACTTTCCACTGCAGCTGTGG - Intergenic
1026278069 7:68897639-68897661 CACGCTTTCCACCGAACCTGAGG - Intergenic
1027440398 7:78213194-78213216 AAGTCTTTCTACTCAAGATGTGG + Intronic
1030370102 7:108689754-108689776 GAGGCATTGCACTGAATCTGTGG + Intergenic
1032018052 7:128392360-128392382 AAAGCCTTCGACTGCAGCTGAGG + Exonic
1032300923 7:130686101-130686123 TGGGCTTTCCACTAAACCTGTGG - Intronic
1032547582 7:132756485-132756507 CAGGCTTTACACTGAATCTCTGG - Intergenic
1033097412 7:138442848-138442870 AAAGCCTTCAACTGCAGCTGAGG - Intergenic
1034429699 7:151035057-151035079 AAGGCTTTCCAGGGAAGATTCGG - Intronic
1034604183 7:152295711-152295733 ATGGCTTTCCTCTGAGGCTGGGG - Intronic
1034966098 7:155392095-155392117 ATGGCTTTCCTCGGAAGCTCAGG + Intronic
1035532372 8:363199-363221 AAAGTATTCCACTGAAGCTGTGG - Intergenic
1035616992 8:1009231-1009253 AATGCATTCCACTGAAGGAGGGG - Intergenic
1036497810 8:9285378-9285400 AACACTGCCCACTGAAGCTGAGG - Intergenic
1036753633 8:11458091-11458113 AAGTCTTACCCATGAAGCTGTGG - Intronic
1038764196 8:30412319-30412341 AAGGCTGTCCACTGAGGCTGAGG + Intronic
1038906074 8:31904457-31904479 ACTGCTTTCCACAGTAGCTGAGG - Intronic
1040979311 8:53229387-53229409 TCTGCTTTCCACTGAAGATGAGG - Exonic
1042538359 8:69882256-69882278 AATGCTTTCCTCCGAAGATGAGG + Intergenic
1042743409 8:72076279-72076301 AAGTCTCTCAAATGAAGCTGGGG - Intronic
1047438416 8:124855212-124855234 AAGGCTTCCCAGGGAAGATGTGG + Intergenic
1048556860 8:135486626-135486648 AATCCTTTCTAATGAAGCTGAGG - Intronic
1048793399 8:138125598-138125620 AAGCCTTTCCAAGGAAACTGAGG + Intergenic
1049031754 8:140043435-140043457 AAGGTTTATCACTGAAGGTGAGG - Intronic
1049956986 9:702729-702751 AAGTTTTTCCACTGAAACTAGGG - Intronic
1051656889 9:19391280-19391302 AATGCTTTCCACCTAAGCTCAGG + Intergenic
1052941029 9:34132536-34132558 AAAGCCTTCAACTGCAGCTGAGG + Intergenic
1055619561 9:78110054-78110076 AAGGCCTTCAACTGTAGATGAGG + Intergenic
1055939218 9:81633945-81633967 AAAGCTTTCCACTGAAACACAGG - Intronic
1058939495 9:109799856-109799878 AAGGCTTTCCACTGAAGCTGGGG - Intronic
1060168922 9:121444418-121444440 AAGGCTTGCCCCTGAAGCTCAGG - Intergenic
1060546701 9:124466186-124466208 AAGGCTTTCCCCAGAGCCTGGGG - Intronic
1061026115 9:128050884-128050906 AAGGAATCCCACTGAGGCTGAGG - Intergenic
1062031761 9:134365052-134365074 AACGCTCTCCCCAGAAGCTGTGG - Intronic
1187820519 X:23283135-23283157 AGGGCTTTGCAGTGAAGCTGGGG + Intergenic
1188057727 X:25561074-25561096 AGAGCTTTCCACCGAAGGTGAGG - Intergenic
1188469539 X:30522263-30522285 AAGCCTATCAAATGAAGCTGAGG - Intergenic
1189540441 X:41981990-41982012 AATGCTTTCCAATAAAGCAGTGG - Intergenic
1189566985 X:42252605-42252627 AAAGCTTTCCCCTGAAGATTGGG + Intergenic
1191830427 X:65408789-65408811 AAAGCTTTCCACTGAAACACAGG + Intronic
1192446550 X:71215412-71215434 CATGCTTCCCTCTGAAGCTGGGG + Intronic
1198026969 X:132716464-132716486 AAGCCTTTCCACTCATGATGTGG + Intronic
1200132858 X:153860952-153860974 AGGGCTTACCTCTGTAGCTGGGG - Intergenic