ID: 1058941343

View in Genome Browser
Species Human (GRCh38)
Location 9:109815524-109815546
Sequence CAGGGTAGACAGAAACAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058941328_1058941343 25 Left 1058941328 9:109815476-109815498 CCTGGTGACTCACTGTGCTGAGG 0: 1
1: 1
2: 1
3: 18
4: 181
Right 1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG No data
1058941336_1058941343 -2 Left 1058941336 9:109815503-109815525 CCAGGGAAGCAGAAGGGGAGTCA 0: 1
1: 0
2: 2
3: 42
4: 350
Right 1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058941343 Original CRISPR CAGGGTAGACAGAAACAGGG GGG Intronic
No off target data available for this crispr