ID: 1058944897

View in Genome Browser
Species Human (GRCh38)
Location 9:109847003-109847025
Sequence CAATGTGGCCAGTGGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058944888_1058944897 10 Left 1058944888 9:109846970-109846992 CCTAACCAGGCACATGGCATTCC 0: 1
1: 0
2: 2
3: 12
4: 156
Right 1058944897 9:109847003-109847025 CAATGTGGCCAGTGGGGAGATGG No data
1058944889_1058944897 5 Left 1058944889 9:109846975-109846997 CCAGGCACATGGCATTCCGTTCC 0: 1
1: 0
2: 1
3: 2
4: 84
Right 1058944897 9:109847003-109847025 CAATGTGGCCAGTGGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058944897 Original CRISPR CAATGTGGCCAGTGGGGAGA TGG Intronic
No off target data available for this crispr