ID: 1058947770

View in Genome Browser
Species Human (GRCh38)
Location 9:109875072-109875094
Sequence CTGAAGATGGAGAAGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 0, 2: 7, 3: 86, 4: 700}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058947770_1058947783 29 Left 1058947770 9:109875072-109875094 CCTGCCTTCTTCTCCATCTTCAG 0: 1
1: 0
2: 7
3: 86
4: 700
Right 1058947783 9:109875124-109875146 TTATTATGGTCCAGCCACTCGGG No data
1058947770_1058947782 28 Left 1058947770 9:109875072-109875094 CCTGCCTTCTTCTCCATCTTCAG 0: 1
1: 0
2: 7
3: 86
4: 700
Right 1058947782 9:109875123-109875145 CTTATTATGGTCCAGCCACTCGG No data
1058947770_1058947777 15 Left 1058947770 9:109875072-109875094 CCTGCCTTCTTCTCCATCTTCAG 0: 1
1: 0
2: 7
3: 86
4: 700
Right 1058947777 9:109875110-109875132 CACCCCAACCTCACTTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058947770 Original CRISPR CTGAAGATGGAGAAGAAGGC AGG (reversed) Intronic
900317714 1:2067681-2067703 GTGAAGATGGAGAAACAAGCGGG - Intronic
900530195 1:3149281-3149303 CTGAAGAAGATGAAGCAGGCAGG + Intronic
900625688 1:3607567-3607589 GTGAGGATGGAGAAGGTGGCAGG + Intronic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901774904 1:11553850-11553872 CTGGTGATGAAGTAGAAGGCAGG - Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903926102 1:26831809-26831831 CTGAAGAATGAGTAGAGGGCTGG - Intronic
903974134 1:27138184-27138206 GTGAGAATGGAGAAGAGGGCAGG - Intronic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904991587 1:34597802-34597824 TTGTAGGTGGAGAAGAAGGGAGG - Intergenic
905313572 1:37066870-37066892 ATGAAGATGGGGAAGGAGGGAGG - Intergenic
905680721 1:39869199-39869221 CTGAAGCAGGAGAATCAGGCAGG - Intronic
905908675 1:41638973-41638995 AAGAAAGTGGAGAAGAAGGCTGG + Intronic
905922458 1:41728581-41728603 CTGTAGATTGAGAACAAGTCTGG - Intronic
905937321 1:41834949-41834971 ATGAAGCTGGAGCAGCAGGCAGG + Intronic
905945829 1:41900836-41900858 GTGAGGCTGGAGAAGTAGGCAGG + Intronic
906641386 1:47442984-47443006 CTGAAGGCAGAGAAGAAGGGAGG + Intergenic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
906852956 1:49271714-49271736 CCAAAGATGGAGAAGAAGGAGGG - Intronic
907110706 1:51923901-51923923 CTGAAGAATGAGAAGAAGTTAGG - Intronic
907937439 1:59055380-59055402 CTGAAGTTGGAGAAGTTAGCAGG + Intergenic
908733799 1:67254992-67255014 ATGCGGATGGAGAAGGAGGCTGG - Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
910006772 1:82406867-82406889 GTGAAGATGGAGATGAAGATAGG + Intergenic
910326375 1:86012811-86012833 ATGAAGTTGGAAAAGTAGGCAGG - Intronic
910408359 1:86914410-86914432 GTAAACTTGGAGAAGAAGGCGGG - Exonic
911105670 1:94129598-94129620 CTGAAGATTGAGAAGAAAGTTGG - Intergenic
911411860 1:97519848-97519870 CAGCAGATGGAGAAGAAAGATGG - Intronic
911701054 1:100952024-100952046 TTGAAGATGGAGGAAGAGGCCGG + Intronic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
913022951 1:114805230-114805252 CTGATGCAGGAGAAGCAGGCAGG + Intergenic
913703287 1:121395897-121395919 ATGGAGATGGAGTGGAAGGCCGG - Intergenic
913979461 1:143497061-143497083 ATGGAGATGGAGTGGAAGGCCGG - Intergenic
914073865 1:144322711-144322733 ATGGAGATGGAGTGGAAGGCCGG - Intergenic
914105289 1:144643649-144643671 ATGGAGATGGAGTGGAAGGCCGG + Intergenic
914317438 1:146527292-146527314 CTAAAGATGGGTGAGAAGGCAGG - Intergenic
914496918 1:148206068-148206090 CTAAAGATGGGTGAGAAGGCAGG + Intergenic
914712255 1:150225365-150225387 ATGAAGCTGGAGGAGAAAGCAGG + Intronic
914828641 1:151154537-151154559 CTGAAGCTGGAGAGGAAAACAGG + Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915090419 1:153420247-153420269 CTGAGGATGCAGAAACAGGCAGG + Exonic
915156968 1:153885051-153885073 CAGAAGATGGAGAACAGGGCCGG - Intronic
915240990 1:154521578-154521600 CTGACTGTGGAGAAGAAGGCAGG + Intronic
915513236 1:156398469-156398491 TTTAAAATGGAGAACAAGGCCGG - Intergenic
916037191 1:160932758-160932780 CTGAGGCAGGAGAAAAAGGCAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916501928 1:165394762-165394784 CTGGCCTTGGAGAAGAAGGCAGG - Intergenic
916942795 1:169693844-169693866 TTGAAGTTGGAAAGGAAGGCTGG - Intronic
917726928 1:177837071-177837093 CTGAAGATGGGGAAAGAGGGAGG + Intergenic
918212714 1:182365812-182365834 ATGAAGCTGGAGAAGCAGGGAGG + Intergenic
919424912 1:197417818-197417840 CTGAAGATGGAGACAATGGAAGG + Intronic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
919658613 1:200221687-200221709 CGGAAGCTGGGGGAGAAGGCAGG - Intergenic
920041878 1:203103354-203103376 GGGAAGATGGGGAAGGAGGCAGG - Intronic
920052162 1:203170860-203170882 CTGAAGACTGTGAAGAGGGCTGG - Intronic
920235836 1:204504183-204504205 ATGAAGATGGACAGGAAAGCAGG - Intergenic
920596841 1:207280240-207280262 CTGAAGAAGGGGATGAAGGAGGG + Intergenic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
920979782 1:210822325-210822347 ATGAGGATGGAGAGGCAGGCAGG + Intronic
921188807 1:212692163-212692185 TTGGAGATGGAGAACAAGGAGGG + Intronic
921190997 1:212708678-212708700 CTGATGAAGGAGAAGAAATCAGG + Intergenic
922226848 1:223652871-223652893 CTGCCAATGGAGAAGGAGGCTGG - Intronic
922438424 1:225629277-225629299 CGGAAGAAAGAAAAGAAGGCAGG + Intronic
923274480 1:232384590-232384612 CTGGAGGTGGAGAAGAAAGGAGG + Intergenic
923482159 1:234395745-234395767 ATGAAGAGTGAGAAGAAGACTGG + Intronic
923490880 1:234483019-234483041 GTGAAGATGGAGAATTAGGCAGG - Intergenic
923764752 1:236882687-236882709 TTCAAGATGGTGAAGGAGGCCGG - Intronic
924263033 1:242251612-242251634 CTGAACATGGAGAAAAGGGCAGG + Intronic
924910423 1:248506157-248506179 ATGAACATGGAGAAGACAGCAGG - Intergenic
924913677 1:248541882-248541904 ATGAACATGGAGAAGACAGCAGG + Intergenic
1062846029 10:706285-706307 TTGGAGAAGGAGAAGAAGGGAGG - Intergenic
1063326049 10:5103181-5103203 CTGAAGATGAAGAGGAGGCCAGG - Intronic
1064039603 10:11948426-11948448 ATGAAGAAGAAGAAGAAGGTGGG - Exonic
1064070884 10:12227155-12227177 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1064212217 10:13369645-13369667 TTGAAAAAGGAGTAGAAGGCCGG + Intergenic
1064490562 10:15851377-15851399 GTGAAGAGGGAGATGCAGGCAGG - Intronic
1065382220 10:25101961-25101983 CAGGAGATGGAGCTGAAGGCAGG + Intergenic
1066284010 10:33946310-33946332 CTGAATATGTAAAAGAAGGAAGG + Intergenic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1066577208 10:36839271-36839293 CTGGAGCTGGTGAGGAAGGCAGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1066721752 10:38346837-38346859 CCGAACATGGAGAAAAGGGCAGG - Intergenic
1066744997 10:38600221-38600243 GTGGAGATGGGGTAGAAGGCTGG - Intergenic
1066956267 10:42177027-42177049 GTGGAGATGGGGTAGAAGGCCGG - Intergenic
1067120221 10:43466087-43466109 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1068303537 10:55176180-55176202 CTGAGGGAGGAGAAGAAGCCTGG - Intronic
1069757466 10:70782001-70782023 CTGAAACTGGAGAAGAAGTCAGG - Exonic
1070135308 10:73689083-73689105 CTGAAGCAGGAGAATCAGGCAGG - Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070571306 10:77640884-77640906 GTGAGGATGAAAAAGAAGGCTGG + Intergenic
1070845233 10:79516915-79516937 CGGGAGATGGAGATGAAGGCAGG - Intergenic
1070928565 10:80243393-80243415 AGGGAGATGGAGATGAAGGCAGG + Intergenic
1071412259 10:85408268-85408290 CCAAAGCTGGAGGAGAAGGCTGG + Intergenic
1071462137 10:85908734-85908756 TTGAAAATGAAGAACAAGGCAGG + Intronic
1071515240 10:86292606-86292628 CTGAAGAGAGGGAGGAAGGCAGG - Intronic
1071904825 10:90161299-90161321 CTCAAGATCAAGAGGAAGGCTGG - Intergenic
1071970127 10:90896674-90896696 CTGGTGAGGGAGAAGAAGGAAGG - Intronic
1072314024 10:94184303-94184325 GTTAAGTTGGAGAAGTAGGCAGG - Intronic
1073350103 10:102813469-102813491 CTGGAGATGGAGGAAAATGCAGG - Exonic
1073838736 10:107473913-107473935 CTGAAAATGTAGAAGTAGGTAGG + Intergenic
1074207535 10:111297005-111297027 CTCAAGGTAGAGATGAAGGCAGG + Intergenic
1075083273 10:119397739-119397761 CTGATGCTGGAGAAGAACGAGGG - Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075667719 10:124242960-124242982 CTGAGGAGGGAGAAACAGGCGGG + Intergenic
1076401364 10:130187616-130187638 CTGAAGATGACACAGAAGGCAGG - Intergenic
1076589570 10:131573954-131573976 CTGAAGCTGGAGGGGAAGGTGGG - Intergenic
1076820933 10:132939251-132939273 AGGAAGATGGAGGAGAAGGGAGG + Intronic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077069324 11:660768-660790 CTGACACTGGAGAACAAGGCAGG + Intronic
1077171574 11:1168638-1168660 CTGAAGATGGTGACGTTGGCTGG - Exonic
1077680306 11:4233816-4233838 TTGCAAATGGAGGAGAAGGCAGG + Intergenic
1077681179 11:4242090-4242112 TTGCAAATGGAGGAGAAGGCAGG - Intergenic
1077684584 11:4279236-4279258 TTGCAAATGGAGGAGAAGGCAGG + Intergenic
1077685458 11:4287533-4287555 TTGCAAATGGAGGAGAAGGCAGG - Intergenic
1077689716 11:4330393-4330415 TTGCAAATGGAGGAGAAGGCAGG + Intergenic
1077690610 11:4338694-4338716 TTGCAAATGGAGGAGAAGGCAGG - Intergenic
1077795715 11:5489475-5489497 GTGAGGAAGGAGAAGAAGGCAGG - Exonic
1077801615 11:5544718-5544740 GCGAGGATGGAGAAAAAGGCAGG + Exonic
1078385830 11:10891713-10891735 TTGAAGAAGGAGAAGAAGATGGG + Intergenic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1079489128 11:20967882-20967904 ATGAATTTGGAGAAGTAGGCAGG - Intronic
1081081786 11:38750659-38750681 CTTAAGTTCCAGAAGAAGGCAGG - Intergenic
1081470815 11:43368833-43368855 CTGAGGCTGGAGGAGAAGACAGG - Intronic
1081601962 11:44501466-44501488 CTCAAGATGGACATGAAGGCTGG - Intergenic
1081800921 11:45858803-45858825 ATGAAGATGGCCAAGGAGGCTGG + Exonic
1082059310 11:47847070-47847092 CTGAGGCTGGAGAGGTAGGCAGG - Intronic
1082711694 11:56560723-56560745 TTGAAAATAGAGAAGAAGCCAGG - Intergenic
1082805432 11:57446395-57446417 CTGAAGATGAACAGGGAGGCAGG + Intergenic
1083372397 11:62192639-62192661 TTGAACAGGGAGAAGAAGGCAGG + Intronic
1083378285 11:62243876-62243898 TTGAACAGGGAGAGGAAGGCAGG + Intronic
1083503658 11:63134880-63134902 ATGAAGCTGGAGAGGGAGGCAGG - Intronic
1084143584 11:67250684-67250706 CTCAGGATGGAGACGAAAGCTGG + Exonic
1084577042 11:69995765-69995787 CTGACGGTGGAGAAGCAGCCAGG - Intergenic
1084595456 11:70114178-70114200 TTAAAGATGGAGAAACAGGCTGG + Intronic
1085294453 11:75423240-75423262 CAGGGGATGGAGAAGAAGGTAGG + Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1086048286 11:82559090-82559112 CTGAAGATGGAAAAGTAAGCAGG + Intergenic
1086225582 11:84504556-84504578 CTGAAGATGAAAAAGAATGTTGG - Intronic
1086609023 11:88731206-88731228 ATGAAGCTGGAGAAGTGGGCAGG - Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1088458403 11:110057125-110057147 CTGAGGGTTGAGGAGAAGGCAGG - Intergenic
1088461325 11:110086516-110086538 CTGAACTAGCAGAAGAAGGCAGG - Intergenic
1088548611 11:110987419-110987441 ATGAAGCTGGAGAGGCAGGCAGG - Intergenic
1088789086 11:113208370-113208392 ATGAGGCTGGAGAAGAAGGCAGG - Intronic
1089772788 11:120815431-120815453 CTGATGATGGAGCTGGAGGCTGG - Exonic
1089894085 11:121909872-121909894 ATGAAGTTAGAGAAGAAAGCTGG - Intergenic
1089895918 11:121929879-121929901 CTTAAGAAGGAGGGGAAGGCGGG + Intergenic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090907049 11:131085045-131085067 CTGAGGCAGGAGAATAAGGCAGG + Intergenic
1090937838 11:131360979-131361001 CTGAACATTGAGAAGAGGGCAGG + Intergenic
1090991878 11:131825096-131825118 CAGAAGCTGGACAAGAAGCCTGG - Intronic
1091112189 11:132979838-132979860 ATGCTGATGGAGAAGAAGGCAGG + Intronic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1092175275 12:6400466-6400488 ATGAAGCTAGAGAAGTAGGCGGG + Intergenic
1092209611 12:6637867-6637889 CTGAGGAAGGCCAAGAAGGCTGG - Intergenic
1092296190 12:7200789-7200811 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1092729173 12:11512291-11512313 TTGAACATGGAAAAGAGGGCAGG + Intergenic
1092735622 12:11579775-11579797 CTGAACTGGGAGAAGAAGGGTGG - Intergenic
1092948369 12:13477142-13477164 ATGAAGATTGAGAAGGAGCCAGG + Intergenic
1093516329 12:19990808-19990830 CTTAAGAGGGAGAGGGAGGCAGG + Intergenic
1094267408 12:28574577-28574599 CTGAAGCTGGATAAGAAGAAGGG + Intronic
1095042608 12:37459411-37459433 CCGAAGACACAGAAGAAGGCAGG - Intergenic
1095138250 12:38633067-38633089 ATGAAGATGGAGAAAACTGCAGG + Intergenic
1095314254 12:40740570-40740592 CTGAAGAGGGAGGCCAAGGCTGG - Intronic
1095828763 12:46560181-46560203 ATGAAAATGGAGAAGAAGGCAGG + Intergenic
1096420512 12:51453562-51453584 TTGAAGATGGGGGAGAACGCTGG + Exonic
1096972580 12:55679705-55679727 CTGAAGATGGGGATGAAAGAGGG + Intergenic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1097914764 12:65009153-65009175 GGGAGGATGGAGAAGAAGGCAGG - Intergenic
1098385546 12:69914960-69914982 CTGATGATGGAGGAGAAGCCCGG + Intronic
1098416452 12:70240622-70240644 GGGAAGATGGAGAAGTGGGCAGG + Intergenic
1098758003 12:74389549-74389571 CTGAAGCTGGATAAGGAGGTCGG + Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1100140040 12:91606627-91606649 TTGAAGATGGATAGGAAGGCAGG + Intergenic
1100721418 12:97362789-97362811 TTGAAGATGGAGAAGACCACAGG - Intergenic
1101217033 12:102595327-102595349 CTGAGGATGGTGAAGATAGCTGG + Intergenic
1101233944 12:102769289-102769311 TTGAAGACTGAGTAGAAGGCAGG + Intergenic
1101446287 12:104738972-104738994 CTGAAGACGGAGGACCAGGCTGG + Intronic
1101545686 12:105710284-105710306 ATGAAGTTGGAGAAGTAGGCAGG - Intergenic
1101902461 12:108800685-108800707 CTGCAGATGCAGAAGTCGGCTGG - Intronic
1102558900 12:113748290-113748312 CTGAAGAGGGAGAAGAAACCTGG - Intergenic
1102730167 12:115102161-115102183 GTGAAGATGGAGAAGGACGAGGG + Intergenic
1103013610 12:117476827-117476849 ATGAAGATGGGCAAGAAGGTGGG - Intronic
1103172802 12:118836088-118836110 ATGGAGATGGACAAGAAGGCAGG - Intergenic
1103250720 12:119497654-119497676 TTGAACTTCGAGAAGAAGGCTGG + Intronic
1103581074 12:121916002-121916024 ATGAAGCTGGAGGGGAAGGCTGG + Intronic
1103887055 12:124210398-124210420 CTTAAGATGGAGAAGAGGAGAGG - Intronic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400655 12:128473287-128473309 GTGAAGATGAAGACGGAGGCTGG - Intronic
1104400658 12:128473311-128473333 CTGAAGATGAAGATAGAGGCTGG - Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104999883 12:132683361-132683383 CTGAAGATGAAGAAGCAGCAAGG + Intronic
1105974155 13:25458634-25458656 CAGAAGGTGGAGTGGAAGGCAGG + Intronic
1105991726 13:25628675-25628697 CAGAAGCTGGAGGAGAAGCCTGG - Intronic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106197824 13:27509301-27509323 AGGAAGATGGAGAAGAAAACAGG - Intergenic
1106287277 13:28328874-28328896 GGGATGATGGAGAAGCAGGCGGG + Intronic
1107415395 13:40195098-40195120 CTGGTGATGAAGAAGAAGGAGGG - Intergenic
1107619707 13:42213763-42213785 CTGCAGATGAGCAAGAAGGCAGG - Intronic
1107982060 13:45743430-45743452 CCCAAGATGGAGAAGATGGTGGG - Intergenic
1108393901 13:49974438-49974460 TTAAAGATGGAGAAACAGGCCGG - Intergenic
1109831393 13:67794398-67794420 CTGAAGATAGCAAAGAATGCTGG - Intergenic
1110476708 13:75923838-75923860 CTGAAGATGGGGGAGAATGAAGG + Intergenic
1110904404 13:80867373-80867395 ATGGAGATGGAAAAAAAGGCTGG - Intergenic
1111203368 13:84969660-84969682 CTGGAGGTAGAGAAGAAGGGTGG - Intergenic
1111379436 13:87427529-87427551 CGGAAGATGGAGTAGAGAGCTGG + Intergenic
1111985101 13:95057966-95057988 CTGCAGAGGGTGGAGAAGGCTGG - Intronic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1112606309 13:100910147-100910169 ATGAAGCTGGAGAGGTAGGCAGG + Intergenic
1113401100 13:109994131-109994153 CTGAAGATGATGAAGGAGCCAGG + Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1113674010 13:112195917-112195939 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1113674102 13:112196299-112196321 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1114183502 14:20383645-20383667 CTGTACATGGAGAGGAAGTCAGG + Intronic
1115616830 14:35103222-35103244 ATGAAGTTGGAGAAGTAGGCAGG - Intronic
1116408978 14:44600912-44600934 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1116614457 14:47116460-47116482 TTGAGGATGGAGAACAAAGCAGG + Intronic
1116788099 14:49309943-49309965 CTGAGCATGAAGAACAAGGCAGG + Intergenic
1117218127 14:53573328-53573350 ATGAAGAATGAGAAGAACGCTGG + Intergenic
1117473562 14:56071015-56071037 ATGTGGAAGGAGAAGAAGGCAGG + Intergenic
1117652459 14:57921265-57921287 ATGCAGAGGGATAAGAAGGCAGG + Intronic
1118186373 14:63542546-63542568 CAGAAGGTGGAGAAAAAGGGGGG + Intronic
1119235746 14:73017787-73017809 CTGTAGAGGGACAAGAAGGAAGG - Intronic
1120242140 14:81961826-81961848 CTGAGGCAGGAGAAGAAGCCAGG - Intergenic
1120505933 14:85353369-85353391 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1120547739 14:85830530-85830552 CTGAGGCAGGAGAATAAGGCAGG + Intergenic
1120818527 14:88889786-88889808 CTGAAGATTGAAAAGGAGGCAGG + Intergenic
1121726133 14:96151448-96151470 GTGAAGCTGGGGAAGCAGGCAGG + Intergenic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1122033640 14:98931935-98931957 CTGAAGATCAAGCAGAGGGCAGG + Intergenic
1122034271 14:98936071-98936093 TAGAGGATGGAGAACAAGGCTGG + Intergenic
1124205558 15:27716066-27716088 ATGGAGATGGAGAAGAAGGGTGG - Intergenic
1124218897 15:27832424-27832446 CTGTAGATGGGCAAAAAGGCTGG - Intronic
1125470058 15:39993668-39993690 GTTAAGCTGGAAAAGAAGGCAGG + Intronic
1125972556 15:43923617-43923639 ATGAAGCTGGAGAAATAGGCAGG + Intronic
1126240963 15:46442857-46442879 CTGAAGTTGAAAAAGAAAGCAGG - Intergenic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1127272364 15:57413152-57413174 AGAAAGAAGGAGAAGAAGGCCGG - Intronic
1127451279 15:59118781-59118803 CTGAAAAAGGAGGAGATGGCAGG - Intronic
1127682180 15:61308662-61308684 CTGGGGGTGGAGAAGAAGGAAGG - Intergenic
1127877443 15:63122673-63122695 CTGTAGATGGAAAAGAAGTCTGG + Exonic
1128013577 15:64321825-64321847 CTGAAAGTGGAGAAGAATGGAGG + Intronic
1128121454 15:65150853-65150875 CTGGAGTTGAAGAAGAAGGATGG - Exonic
1128470378 15:67946578-67946600 CTGATGATGCAGTACAAGGCTGG - Intergenic
1128510766 15:68312774-68312796 CTGAAGATGCAGCTGAAGGGAGG + Exonic
1128590177 15:68888517-68888539 GGCAAGATGGAGATGAAGGCAGG - Intronic
1128687229 15:69695815-69695837 TGGAAGTTGGAGAAGAAGACAGG - Intergenic
1128749809 15:70140794-70140816 CTGCAGCTGGAGAAGAAGGCAGG + Intergenic
1129677675 15:77641242-77641264 CATCAGCTGGAGAAGAAGGCAGG - Intronic
1132504171 16:298397-298419 CTGAGGATGGAGAGGCAGGACGG + Intronic
1133392224 16:5419824-5419846 TTGAAGATGGAGAAGGAGTGTGG + Intergenic
1133463620 16:6008634-6008656 TTGAAGATGGAGCAGAGGGAAGG + Intergenic
1133584943 16:7184053-7184075 GTGGTGGTGGAGAAGAAGGCAGG + Intronic
1133624921 16:7562360-7562382 CTGAAGTTACAGAAGAGGGCAGG + Intronic
1133797778 16:9060175-9060197 TTAAATATGGAGAAGAAGGAAGG + Intergenic
1133854440 16:9536451-9536473 CTGAAACTGGAGAGGCAGGCAGG + Intergenic
1133987404 16:10678918-10678940 CTAAAGATGGAGAGGACAGCTGG + Intronic
1134296621 16:12951872-12951894 CTGAAGATGGAGAAATATGCAGG + Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135008963 16:18856059-18856081 ATAAAGATGAGGAAGAAGGCAGG - Intronic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135523585 16:23196365-23196387 ATGAGGAGGGAGAAGTAGGCAGG + Intronic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1135637691 16:24093098-24093120 TTGCAGATGGAAAAGAAGGGAGG - Intronic
1136567058 16:31076863-31076885 CTGAGGATGGTGCAGACGGCTGG + Exonic
1136698950 16:32115558-32115580 ATGGAGATGGGGTAGAAGGCCGG - Intergenic
1136737874 16:32478770-32478792 GTGGAGATGGGGTAGAAGGCCGG + Intergenic
1136768658 16:32812270-32812292 ATGGAGATGGGGTAGAAGGCTGG + Intergenic
1136799457 16:33058858-33058880 ATGGAGATGGGGTAGAAGGCCGG - Intergenic
1136957127 16:34801808-34801830 GTGGAGATGGGGTAGAAGGCCGG - Intergenic
1137007866 16:35295366-35295388 CTGAAGGTGGAGCAGAGGCCAGG - Intergenic
1137014560 16:35362218-35362240 CTGAAGACGGAGCAGAGGCCAGG - Intergenic
1137033248 16:35544169-35544191 ATGGAGATGGAGAAGCAGTCAGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1138279885 16:55764674-55764696 CTGGATATGGAGAAGAAATCAGG - Intergenic
1138749217 16:59398631-59398653 CTGAGGATTGAGAAGGAGCCAGG - Intergenic
1138845626 16:60562241-60562263 CTGAATATGGAATAGAAGGCAGG + Intergenic
1138913468 16:61431845-61431867 ATGAAAGTGGAGAAGAAGGCCGG - Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139392624 16:66614519-66614541 CTGAAAATGGGTAAGAAAGCTGG + Intergenic
1139819818 16:69712397-69712419 CTGGAGAAGGACAGGAAGGCTGG + Intronic
1140195941 16:72855449-72855471 CTGGAGATGGAAAAGATGGCAGG + Intronic
1140787765 16:78360287-78360309 TAGAAGTTGGAGAAGTAGGCTGG + Intronic
1140928491 16:79605649-79605671 GTGAAGAAAGAGAAGAAGGCTGG - Intergenic
1141148019 16:81545554-81545576 CTGTAGATGGAGGAGGATGCTGG - Intronic
1141202812 16:81910729-81910751 CTGAGGGTGGAGCAGGAGGCAGG + Intronic
1141280380 16:82625709-82625731 ATCAAGATGCAGCAGAAGGCAGG - Intergenic
1141585609 16:85031583-85031605 ATGAAGCTGGAGAAACAGGCAGG - Intronic
1141981256 16:87551748-87551770 GTGAAGATGGAGGAGGAGACTGG + Intergenic
1142199057 16:88752614-88752636 CTGAGGATGGAGATGAGGGAGGG + Intronic
1203015198 16_KI270728v1_random:350807-350829 GTGGAGATGGGGTAGAAGGCCGG - Intergenic
1203033533 16_KI270728v1_random:623965-623987 GTGGAGATGGGGTAGAAGGCCGG - Intergenic
1203071075 16_KI270728v1_random:1074378-1074400 ATGGAGATGGGGTAGAAGGCCGG + Intergenic
1142499692 17:325373-325395 AGGAAGATGGAGAGGTAGGCAGG - Intronic
1142822909 17:2486139-2486161 GTGAAGCTGGGGAGGAAGGCAGG + Intronic
1143658861 17:8312679-8312701 CTGAAAACGGAGAAGATGGGTGG - Intronic
1144348970 17:14375914-14375936 TTAAAAATGGTGAAGAAGGCCGG - Intergenic
1144486668 17:15671728-15671750 GTTAAGATTGAGAATAAGGCCGG + Intronic
1144877714 17:18411095-18411117 CAGAAGGTGGGGAAGAAGACTGG - Intergenic
1145026936 17:19475455-19475477 CTGAGGAAGGAGAATCAGGCAGG - Intergenic
1145154515 17:20533308-20533330 CAGAAGGTGGGGAAGAAGACTGG + Intergenic
1145693096 17:26765802-26765824 GTGGAGATGGGGTAGAAGGCCGG - Intergenic
1145901380 17:28492583-28492605 ATGAAGCTGGAGAAGTAGGCAGG + Intronic
1146349980 17:32085047-32085069 CGGAGGATGGAGGAAAAGGCGGG - Intergenic
1146393103 17:32441023-32441045 TCGAAGTTGGAGAAGTAGGCAGG + Intergenic
1146921865 17:36718547-36718569 ATGAAGCTGGAGAGGCAGGCAGG - Intergenic
1147762138 17:42805617-42805639 CTGAAGATGAAGGAATAGGCTGG + Intronic
1148452883 17:47791540-47791562 CTGGAAGTGGAGAAGAAGGTAGG - Intergenic
1148546559 17:48523725-48523747 TAGAAGATGGATAAGAAGTCTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148719587 17:49741545-49741567 CTTAAGGAGGAGAAGCAGGCAGG + Intronic
1148824045 17:50379034-50379056 CAGAAGATACAGAAGAAGACTGG - Intronic
1149114907 17:53081551-53081573 ATGAAGCAGGAGAGGAAGGCAGG + Intergenic
1150739915 17:67771108-67771130 TTGAAGATGGTGAAGTGGGCTGG - Intergenic
1151752719 17:76050031-76050053 CTGCAAAGGGAGAAGAAGGTGGG + Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1153460919 18:5332315-5332337 ATGAAGACGGAGGAGAAGGGAGG + Intergenic
1153784875 18:8525849-8525871 CTGAGGCTGGAGAAGAAAGCAGG + Intergenic
1154031516 18:10757407-10757429 ATGAAGATGAGGAAGAAGGCTGG + Intronic
1154072227 18:11163014-11163036 TTGAAGAATGAGAAGAAGACAGG - Intergenic
1155333168 18:24738309-24738331 CTGGAGCTGGAGGAGAAAGCAGG + Intergenic
1155372818 18:25121252-25121274 AGGAAGAAGAAGAAGAAGGCTGG - Intronic
1155415012 18:25588711-25588733 CTGATGGTGGAGAAGAAAGGAGG + Intergenic
1155545178 18:26907293-26907315 CAGAAGATGGAGTAGATGGATGG + Exonic
1155847208 18:30723082-30723104 CTGAGGAGGGAAAAGAAGACTGG - Intergenic
1155923438 18:31628924-31628946 TTGAAGATGGAAAAGGAGGCAGG - Intronic
1155930024 18:31697307-31697329 CAGCAAATGGAGAAGATGGCAGG + Intergenic
1157134899 18:45044652-45044674 ATGAAGCTGGGGCAGAAGGCAGG - Intronic
1157209904 18:45733243-45733265 CTAAAGAAGGAGAAGAAGACGGG + Intronic
1157907509 18:51582757-51582779 CTGCTGTTGGAGAAGGAGGCTGG + Intergenic
1158077363 18:53546150-53546172 CTGAAGATGCAGTTGAAGACAGG + Intergenic
1158145040 18:54302797-54302819 GTGAAGATAGAGTAGAAGGATGG - Intronic
1158253381 18:55516140-55516162 CTGTAGATGGAAAAGATGACTGG + Intronic
1158692872 18:59676974-59676996 ATGAAGGTGGAGAGGAAGACAGG + Intronic
1159751555 18:72308532-72308554 CTGATAAGGGAGAAGAATGCAGG + Intergenic
1159942839 18:74421730-74421752 GTGAAGCTAGAGAAGCAGGCAGG - Intergenic
1160017764 18:75157556-75157578 GTGAAGATGGAGGGGAAGACGGG + Intergenic
1160227009 18:77019419-77019441 GTGAAGATGGAGGAGGAGCCTGG + Intronic
1160293530 18:77617093-77617115 CTGAAAAGTGGGAAGAAGGCAGG - Intergenic
1160318200 18:77867316-77867338 CTGCAGGTGGAGAGGAAGGTGGG - Intergenic
1160391900 18:78540350-78540372 CTGAAGATGGAGGTGGAGGCTGG + Intergenic
1161312217 19:3601048-3601070 ATGAAAATGGAGGAAAAGGCCGG - Intronic
1161517376 19:4703954-4703976 TTGATGAAGGAGAAGAAGGCAGG + Exonic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1162788868 19:13052942-13052964 GTGGGGATGGAGGAGAAGGCAGG - Intronic
1162929246 19:13948506-13948528 TTGAAAATGGAGAATACGGCCGG - Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1162982305 19:14247956-14247978 CGGAGGATGGAGGAAAAGGCGGG + Intergenic
1164441118 19:28281691-28281713 ATGAAGAGGGAGAAGAGGGTGGG - Intergenic
1165333151 19:35152592-35152614 GTGAGGATGGAGAAGAAAGCTGG + Intronic
1165481223 19:36065676-36065698 CGGCAGAGGGAGAAGAAAGCAGG + Intronic
1165577890 19:36837395-36837417 CTGAAAATGGAACAGATGGCCGG + Intronic
1165762423 19:38329501-38329523 CTGGAGATGGAAAAGCATGCTGG + Intergenic
1167100845 19:47403485-47403507 CTGAAGCTGGAGGACCAGGCGGG + Exonic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168164701 19:54538677-54538699 TAGAAGATGGACAATAAGGCTGG - Intronic
1168434224 19:56304584-56304606 TGGAAGATGGGGAAGAAGGTGGG + Intronic
1168596029 19:57678169-57678191 ATGAAGATGAACAAGATGGCTGG + Exonic
1202681428 1_KI270712v1_random:7141-7163 ATGGAGATGGAGTGGAAGGCCGG + Intergenic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925971981 2:9112379-9112401 CTGGAGCTGGAGGGGAAGGCCGG - Intergenic
925980778 2:9175455-9175477 CAGAAAATGGATATGAAGGCAGG - Intergenic
926367163 2:12144000-12144022 ATGTGGCTGGAGAAGAAGGCAGG + Intergenic
926994240 2:18716734-18716756 CTGAAGGTGGAGGGGGAGGCTGG - Intergenic
927103960 2:19808457-19808479 TTGAAGATGGATCAGCAGGCAGG + Intergenic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927710486 2:25322707-25322729 CTGAAGATGGAGAGGAGGCTTGG - Intronic
928365951 2:30703053-30703075 CTGAAGTTGGAGAACAGGGCAGG + Intergenic
928512232 2:32012188-32012210 CTGAAGTTGGAGAAGGTGGGAGG - Intronic
928650378 2:33397815-33397837 TTCAAGATGGAGAAGAGGCCAGG - Intronic
930158033 2:48125462-48125484 CTGAGGCAGGAGAATAAGGCGGG + Intergenic
932253944 2:70267688-70267710 CTGAAGCAGGAGAATCAGGCAGG + Intronic
932404358 2:71503679-71503701 CTGAATCTGGAGAAGAGGGCTGG - Intronic
932498847 2:72162434-72162456 CTGTAGATGGAGAAGCAGTTAGG - Intergenic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
934075267 2:88423001-88423023 CTGATGATTTAGAAGAAGGACGG + Intergenic
934304202 2:91808982-91809004 GTGGAGATGGGGTAGAAGGCCGG - Intergenic
934329053 2:92043768-92043790 GTGGAGATGGGGTAGAAGGCCGG + Intergenic
934467274 2:94273691-94273713 GTGGAGATGGGGTAGAAGGCCGG + Intergenic
934518645 2:95005630-95005652 CTGATGACAGAGAGGAAGGCAGG + Intergenic
934653538 2:96105540-96105562 CTGAAGATGGGCAGGAAGGGTGG - Intergenic
934658428 2:96130033-96130055 AAGCAGAGGGAGAAGAAGGCAGG + Intronic
935416066 2:102820745-102820767 ATGAAGTTGGAGAAGCAGGAAGG + Intronic
936390013 2:112063442-112063464 TTGAAGCTGGAGAAGAGTGCTGG - Intronic
936577621 2:113669138-113669160 CTGAAGAGGGACAAGAAGCAGGG - Intergenic
937312028 2:120908505-120908527 CTGAAAAGGGAAAAGAAGCCTGG + Intronic
937487085 2:122326458-122326480 ATGAAGGATGAGAAGAAGGCTGG - Intergenic
937579499 2:123467109-123467131 CTGCAGATGGCAAAGAAGGAAGG - Intergenic
940126377 2:150330532-150330554 AGGAAGAAGAAGAAGAAGGCTGG + Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941422184 2:165296152-165296174 GGGATGATGGTGAAGAAGGCTGG + Intronic
941530217 2:166660616-166660638 ATGAAGATGGAGAAGGAAGCAGG + Intergenic
941990822 2:171555362-171555384 CTGGGGAGGGAGCAGAAGGCAGG - Exonic
942250940 2:174047312-174047334 CAGAAGAGGAAGAAGAAGCCTGG + Intergenic
943863066 2:192893577-192893599 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
945275947 2:207987780-207987802 ATGAAGATGGAGTGGAAGGCAGG - Intronic
945737509 2:213618304-213618326 GTGAGGATAGAGTAGAAGGCAGG - Intronic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946639407 2:221767281-221767303 CTGAAGTTCGGGAAGAAGGGAGG + Intergenic
947502415 2:230681022-230681044 CTGAAGAACGAGCAGAAGCCAGG + Intergenic
947705585 2:232273017-232273039 GTGAAGGTGGAGGAGTAGGCTGG - Intronic
948006524 2:234613796-234613818 CAAAAAGTGGAGAAGAAGGCTGG + Intergenic
948424009 2:237876590-237876612 CTGAGGAGGAAGAAGAAGCCTGG + Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1168750247 20:276971-276993 CAGAGGATGGGGAAGAGGGCGGG + Intronic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1170841613 20:19928765-19928787 CACAAGAGGGAGAGGAAGGCAGG - Intronic
1171209954 20:23309385-23309407 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1171320164 20:24236035-24236057 CTGGGGATGGAGAGGCAGGCAGG + Intergenic
1172485208 20:35293806-35293828 CTGGAGGAGGGGAAGAAGGCTGG - Intergenic
1172631601 20:36382116-36382138 CTGGAGGTGGAGAAGCAGCCTGG + Intronic
1172700569 20:36851412-36851434 ATGAAGATGGAGAAGTGGACGGG - Intronic
1172806798 20:37617872-37617894 GTGAAGATGGAGGCGAAGACTGG + Intergenic
1173029139 20:39338544-39338566 CAGAGGCTGGAGAAGCAGGCAGG + Intergenic
1173079008 20:39848377-39848399 CTGAAGATAGAACAGAAGTCGGG + Intergenic
1173860144 20:46277890-46277912 CGGTAGCTGGAGAGGAAGGCAGG + Intronic
1174001025 20:47374815-47374837 ATAAAGAAGAAGAAGAAGGCTGG + Intergenic
1174106372 20:48165303-48165325 CTGAAGATGGGCAGGAAGGGTGG + Intergenic
1174510274 20:51046067-51046089 CTGAACATGGAACAGAAGCCAGG - Intergenic
1175344014 20:58257696-58257718 CTTAAAATGGAAAAGAATGCAGG + Intergenic
1175414511 20:58792905-58792927 CTGATGATGGGGGAGAAGACGGG - Intergenic
1175414519 20:58792937-58792959 CTGATGATGGGGGAGAAGACGGG - Intergenic
1175414527 20:58792969-58792991 CTGATGATGGGGGAGAAGACGGG - Intergenic
1175414541 20:58793033-58793055 CTGATGATGGGGGAGAAGACGGG - Intergenic
1175414549 20:58793065-58793087 CTGATGATGGGGGAGAAGACGGG - Intergenic
1175956200 20:62610645-62610667 ATGAAGATGAGCAAGAAGGCAGG + Intergenic
1176249360 20:64112918-64112940 CTGGAGATGTAGGAGAGGGCTGG + Intergenic
1177252357 21:18611151-18611173 CTGAAGATGGAGAATGAGCTAGG + Intergenic
1178307541 21:31503096-31503118 AGGAAAATGGTGAAGAAGGCTGG + Intronic
1178667821 21:34564343-34564365 ATGAAGCTGGAGAGGCAGGCAGG + Intronic
1179003637 21:37487988-37488010 CTCAAGAGTGAGGAGAAGGCAGG - Intronic
1179183348 21:39063214-39063236 CTGGAGATGGAGAACAACGGTGG + Intergenic
1179480965 21:41678405-41678427 CTGCCGATGGAGAAGCAGGGAGG - Intergenic
1179979074 21:44887138-44887160 CTGCTGACAGAGAAGAAGGCAGG + Intronic
1180534518 22:16386678-16386700 GTGGAGATGGGGTAGAAGGCCGG - Intergenic
1180675498 22:17583429-17583451 CTGAAGATGGAGATGCTTGCCGG + Exonic
1180931541 22:19595715-19595737 GGGAAGATGGAGGAGAAAGCTGG + Intergenic
1181771500 22:25128991-25129013 CTGAGGATGGAGACCAAGGGAGG + Intronic
1181886029 22:26023107-26023129 GTGGTGATGGAGAAGAAGGAAGG - Intronic
1182342703 22:29636859-29636881 CTCAAAATGGACAAGAAGGTTGG + Exonic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182934647 22:34209572-34209594 ATGAAGATGGAAAGGTAGGCAGG - Intergenic
1183068105 22:35377592-35377614 TTGAAGATGGAGGATGAGGCTGG - Intergenic
1183153236 22:36054033-36054055 CTGAAAATAGGAAAGAAGGCAGG - Intergenic
1183337694 22:37259958-37259980 CTGAAGGTGGACAGGCAGGCTGG - Intergenic
1183526501 22:38326212-38326234 CTGAAGATGGAAGAGGAGGGAGG - Intronic
1184854278 22:47137922-47137944 CTGAAGAGGGAGGCGAAGGCAGG - Intronic
1184928351 22:47660298-47660320 ATGAAGGTGATGAAGAAGGCAGG - Intergenic
1185045139 22:48524963-48524985 CTGAAGATGGAGGAAGAGGCAGG - Intronic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
1185422609 22:50743526-50743548 CTGAAGAGGGACAAGAAGCAGGG + Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
949411248 3:3766807-3766829 GTGAAGATGGATAATCAGGCAGG + Intronic
949582725 3:5406857-5406879 CTGAAGATGGAGGAGAAGCAAGG - Intergenic
949701258 3:6761807-6761829 ATGAATGTGGAGAAGCAGGCAGG + Intergenic
949853855 3:8442129-8442151 GGGAAGGTGGAGAAGAAGGGAGG + Intergenic
950519143 3:13485969-13485991 ATTAAGATGAAGAAGTAGGCCGG + Intronic
950798453 3:15530379-15530401 CTGAAGGTGGAGATGATGGTTGG + Intergenic
950838424 3:15942879-15942901 TAGAAGAGAGAGAAGAAGGCAGG - Intergenic
950904370 3:16524473-16524495 CTGAAGCTGGAGCAGCTGGCTGG + Intergenic
951120348 3:18919410-18919432 GTGAAGATTTAGAACAAGGCTGG - Intergenic
951303521 3:21028293-21028315 ATGAAGTTGGTGAAGTAGGCAGG - Intergenic
952056811 3:29457157-29457179 ATGGAGGTGGAGAAGAAGGGAGG - Intronic
952169488 3:30791241-30791263 CTGAAAAGGGAGAAAAAGGATGG - Intronic
952498700 3:33938836-33938858 CAGGAGATGGAGAGGAAGGGTGG + Intergenic
952553901 3:34510099-34510121 GTGAAGTTGGAGAAGAATGTGGG + Intergenic
952720699 3:36529757-36529779 CTGCAGTCAGAGAAGAAGGCAGG - Intronic
952881588 3:37989300-37989322 CGGAAGATGGAGACTTAGGCCGG + Intronic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953152626 3:40338921-40338943 CTAAAAAGGGAGAAGAAGCCAGG + Intergenic
953200856 3:40777368-40777390 CTGCAGATGGAGTAGTAGTCAGG + Intergenic
954008541 3:47613811-47613833 GTGAAGAGGGAGAGGAAGGCAGG - Intronic
954090035 3:48276928-48276950 ATTCAGATGGAGAAGAAGGGGGG - Intronic
954481496 3:50804638-50804660 CTGAAGCAGGAGAATCAGGCAGG + Intronic
955028660 3:55195323-55195345 CTAAAGATGGTGATGGAGGCTGG + Intergenic
955083465 3:55679169-55679191 ATGAGGATGGAGAAGAAGGAAGG - Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
956013239 3:64854039-64854061 CTGAACATTGAGCAGAAGGAAGG + Intergenic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
957302230 3:78407206-78407228 CTTAAGGTGGAGAAGAAGACTGG - Intergenic
957325109 3:78681607-78681629 CTTAAGACGGAGAAGCAGCCAGG + Intronic
957335558 3:78823606-78823628 CTGAGGCTGGAAATGAAGGCAGG - Intronic
957390340 3:79558259-79558281 CTGAAGCGGAAGAAGAAGGTTGG - Intronic
957955931 3:87187010-87187032 ATGAAGCTGGGGAAGTAGGCAGG + Intergenic
958911582 3:100000178-100000200 CTGAAGGATCAGAAGAAGGCAGG - Intronic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
961370606 3:126427202-126427224 CTGAAGATGAACAAGAAAACTGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
961951011 3:130749080-130749102 ATTGAGATGGAGAAGAAGGGAGG - Intergenic
961952894 3:130769358-130769380 ATGGAGATGGAGTAGAAGGATGG + Intergenic
962250051 3:133830550-133830572 GTGGAGATGGGGAGGAAGGCTGG - Intronic
962619558 3:137163817-137163839 CTGGAGGTGGAGAACAAGGGAGG - Intergenic
962949891 3:140208584-140208606 GAGAAGATGTATAAGAAGGCAGG - Intronic
963214055 3:142724613-142724635 AAGAGGATGGAGAGGAAGGCAGG - Exonic
963327355 3:143877153-143877175 CTCAAGATGGAGGAGGAGGAGGG - Intergenic
963544182 3:146633872-146633894 CTGAAGGAGGAGAAAAAAGCTGG - Intergenic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
963870452 3:150409336-150409358 TTGGACATGGTGAAGAAGGCTGG - Exonic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
966209846 3:177442023-177442045 CTGAAGATGGAGAGAGAGCCTGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
967322979 3:188212516-188212538 CCAAATATGGAGAAGCAGGCTGG - Intronic
967375574 3:188796877-188796899 TTGAAGATTGTGAAGAAGGGAGG - Intronic
967788118 3:193519359-193519381 ATGGAGTTGGAGAGGAAGGCAGG - Intronic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968167064 3:196475249-196475271 CTGAAGCTGTACAAGAAGTCAGG - Exonic
968422448 4:497159-497181 CTGTCGATGCAGAAGCAGGCAGG + Intronic
968665128 4:1816760-1816782 CTGGAGATGGACCAGCAGGCTGG - Exonic
969331409 4:6475207-6475229 ATGGAGATGGAGATGAAGGCGGG + Intronic
969386883 4:6857365-6857387 CTGCAGATGGAGCATGAGGCTGG - Intronic
970346878 4:15160799-15160821 CTGAGGATGGAGGAGAATGAGGG + Intergenic
970861162 4:20704101-20704123 GAGAAGATGGAGAAGATGACAGG + Intronic
971197194 4:24480833-24480855 CAGAAGATCAAGAAGAAGTCTGG + Intergenic
971234547 4:24829416-24829438 CAGAAGATGGAGAAAAAAGATGG + Intronic
971317893 4:25582608-25582630 ATGAAGAAGGAAAAGAAGACGGG - Intergenic
971419784 4:26464865-26464887 CTGCTGTTGGAGAAGAAGGGAGG - Intergenic
971713286 4:30144784-30144806 CAAAAGATAGAGAAGAGGGCCGG + Intergenic
972339887 4:38142961-38142983 CTGGATATGGAGAGGCAGGCAGG - Intergenic
972696290 4:41449900-41449922 CTGAAGAAGGCCAAGAAGCCTGG - Intronic
972730506 4:41789999-41790021 CTTAAGGAGGAGAAGAAGGAAGG - Intergenic
974510214 4:62830404-62830426 CCTAAGATGGAGAATAAGGCTGG - Intergenic
974517270 4:62934105-62934127 CTGGAGCTGGAGAAGTAGGTAGG - Intergenic
974766489 4:66353973-66353995 CTGAAGGTGATGAAGAAGGCAGG - Intergenic
975825128 4:78311486-78311508 ATGCAGATGGAGAAAAAGGAGGG - Intronic
976149277 4:82077214-82077236 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
976718494 4:88148289-88148311 CTGTAGATGGAAAAGAAGAAAGG + Intronic
976799141 4:88968705-88968727 CTGGATATGGAGAACAGGGCAGG - Intronic
977146600 4:93448968-93448990 AGGGAGATGGAGAAGAAGGAAGG - Intronic
977245238 4:94623249-94623271 ATGAAGCTGGAGAAGAAGGTTGG - Intronic
978063126 4:104363814-104363836 CTGAGGATGAAGGAGAAAGCTGG + Intergenic
978609960 4:110526564-110526586 GTGAAGACGAAGAGGAAGGCAGG + Intronic
978833337 4:113116322-113116344 CAAAAGAGGGAGAGGAAGGCAGG - Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
979220182 4:118214225-118214247 ATGAAGATGAAGAAGAAGGTAGG + Intronic
979702701 4:123686344-123686366 ATGAAGATGGAGAGGTAGGTAGG + Intergenic
980134582 4:128847252-128847274 CTGATGATGGCGGAGAAGCCAGG - Intronic
981721985 4:147811086-147811108 CTGAAAATGAAGAGGAAGCCAGG - Intronic
981917629 4:150052018-150052040 CTGAGGACGGAGAGGTAGGCAGG - Intergenic
982109425 4:152040299-152040321 ATTAGGATGGAGAAGAAGCCTGG + Intergenic
982167522 4:152628288-152628310 CTGAGGGTGGAGAAGGAGGCGGG - Exonic
984191123 4:176606935-176606957 GTGAAGATGGAGAGAGAGGCTGG + Intergenic
984382746 4:179015960-179015982 GTGAAGATGGAGAGAGAGGCTGG - Intergenic
984389150 4:179105865-179105887 ATCAAGATGGAGAAGCAGGGAGG + Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
984678559 4:182579089-182579111 GTGGAGATACAGAAGAAGGCAGG - Intronic
984742762 4:183183015-183183037 CTAGAGAGCGAGAAGAAGGCAGG + Intronic
985104388 4:186486624-186486646 TTTAGGATGAAGAAGAAGGCAGG + Intronic
985376233 4:189342107-189342129 GTGAAGATGGGGGAGAAAGCAGG - Intergenic
985376444 4:189344664-189344686 ATGAAGATGGAGAACAGGGAAGG + Intergenic
985969154 5:3361796-3361818 CTAAAGAATGAGAGGAAGGCAGG + Intergenic
986111961 5:4728225-4728247 GGGAAGATGGAGAAATAGGCTGG + Intergenic
986671329 5:10145592-10145614 CAGAAGATGGGGAAGAGGGGAGG + Intergenic
987177155 5:15325464-15325486 CTGAAGATGATGATAAAGGCTGG + Intergenic
987198727 5:15553174-15553196 ATGAAGCTGGACAAGAGGGCTGG - Intronic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987492171 5:18595030-18595052 TTGAAGACTGAGAAGAAGGCAGG - Intergenic
987759066 5:22135637-22135659 CTGAAGAATGAAGAGAAGGCTGG + Intronic
988549581 5:32187793-32187815 CTGAACATGAAGAAAAAAGCTGG + Intergenic
988673752 5:33409896-33409918 CTGAAAATGGAAAAAAAGGAGGG + Intergenic
990252767 5:53933348-53933370 GTAAAGATGGAGAAAAAGGCCGG + Intronic
991066954 5:62434053-62434075 ATGAAGTTGGAGAAAAGGGCAGG - Intronic
991893778 5:71369083-71369105 CTGAAGAATGAAGAGAAGGCTGG + Intergenic
991914074 5:71588582-71588604 GGGAAGATGGACAAGAAAGCAGG + Intronic
994924838 5:106101208-106101230 TTGAAGATGGAGCAGAAGGAAGG + Intergenic
995390163 5:111632074-111632096 GTGAGGATGCAGAGGAAGGCAGG - Intergenic
995725816 5:115179662-115179684 CGGAAGATGGAGAGGAGGGCGGG - Intronic
996519734 5:124413555-124413577 TGGAGCATGGAGAAGAAGGCAGG + Intergenic
996809777 5:127503795-127503817 CTGTAGTTGGAGAAGAAGTAGGG + Intergenic
997361045 5:133295116-133295138 CTGAGGAGGGAGAAGAAGGTCGG - Intronic
998199046 5:140104118-140104140 TTAGAGATGGAGAAGAAAGCTGG - Intergenic
998207985 5:140173146-140173168 GTGAGGATGGAGTGGAAGGCAGG - Intergenic
998400887 5:141848631-141848653 GAGAAGTTGGAGAAGAAGGCAGG - Intergenic
998809621 5:145953293-145953315 CTGAAGGATGAGAGGAAGGCAGG + Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
998879743 5:146633842-146633864 CTAAGGATGGAGAAGCAGACGGG - Intronic
999065020 5:148676259-148676281 CTGAAGTTGGAGAGGCAGGTGGG + Intronic
999450008 5:151670890-151670912 CTGAAGATGGAGAAGCCAGATGG + Intronic
1000131963 5:158308919-158308941 CTGAAGACATAGAAGAAGGGAGG - Intergenic
1000865535 5:166509658-166509680 CTGAAGAAGGACAAGAAAGAGGG + Intergenic
1001044663 5:168362745-168362767 CTCAAGATGGAGGTGAAGGAAGG + Intronic
1001256661 5:170188639-170188661 ATGAGGATAGAGAAGAAGGAGGG + Intergenic
1001660065 5:173384593-173384615 CTGAATATGTACCAGAAGGCCGG + Intergenic
1003079028 6:3006124-3006146 CCGTAGATCGAGCAGAAGGCTGG - Intronic
1003407588 6:5836547-5836569 CTGAGGCAGGAGAATAAGGCAGG + Intergenic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1003631480 6:7791498-7791520 ATGAAGATGGAGAAGCAGAGAGG - Intronic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004690137 6:17986863-17986885 CTCTAGATGGAGGAGAAGGGGGG + Intronic
1006106704 6:31721251-31721273 CAGCAGATAGAGGAGAAGGCAGG + Intronic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1006644387 6:35505998-35506020 CTGGACACGGAGAAGAAGGTGGG - Exonic
1006851929 6:37104674-37104696 CTGAAGAGTGACAACAAGGCTGG - Intergenic
1007132132 6:39485031-39485053 TTGAAGATGGAGAAATATGCAGG - Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007935153 6:45726364-45726386 CTGGATATTGAGAAGAATGCTGG + Intergenic
1008043969 6:46833051-46833073 CTGAGGACAGAGAACAAGGCTGG - Intronic
1008377756 6:50810668-50810690 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1008923024 6:56862538-56862560 ATGAAGATGAAGATGAAGTCTGG - Intronic
1009464767 6:63955214-63955236 CAGAAGATAGGGATGAAGGCTGG - Intronic
1009954647 6:70438857-70438879 CTTAAGATGGAAAAGACAGCAGG + Intronic
1010017352 6:71120971-71120993 CTTAAGAGAGAGAAGAAGGCCGG - Intergenic
1011203796 6:84869178-84869200 GTGACAAAGGAGAAGAAGGCAGG - Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1013425577 6:110009682-110009704 CTAAACATAGAGAGGAAGGCTGG - Intergenic
1013585384 6:111573845-111573867 CAGAAGATGGAGAAGAAAGGGGG + Intronic
1013853694 6:114545669-114545691 CTGAAGATAGAGAAGGAATCAGG + Intergenic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015655016 6:135508143-135508165 ATTAAGATGCAGAAGAGGGCGGG - Intergenic
1016067628 6:139700435-139700457 TTGATGATGGGGAAGAATGCAGG + Intergenic
1016505800 6:144777707-144777729 CTCATTATGAAGAAGAAGGCAGG + Intronic
1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG + Intronic
1018528288 6:164736903-164736925 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1018931586 6:168243601-168243623 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1018931608 6:168243717-168243739 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1018993978 6:168696704-168696726 CTTAAGATCTTGAAGAAGGCCGG + Intergenic
1019002027 6:168761803-168761825 CTGAAAATGGAGCACAAAGCTGG - Intergenic
1019465964 7:1189138-1189160 AGGAAGAAGAAGAAGAAGGCGGG + Intergenic
1020354311 7:7260203-7260225 GTGATGATGGAGAAGGGGGCCGG - Intergenic
1021496392 7:21279097-21279119 CTGAATATGGAGAAACAGTCAGG - Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022181631 7:27926109-27926131 CTCAAGATGGAGAGGAAGGCTGG + Intronic
1022500482 7:30879527-30879549 CTGAGGTGGGAGAGGAAGGCAGG - Intronic
1022537439 7:31106807-31106829 CTGAGGGGGGAGAAGGAGGCAGG + Exonic
1023218629 7:37894474-37894496 CTGAAGATAGTTAAGGAGGCTGG + Exonic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1024042253 7:45564791-45564813 CTGAAGATGGAGGGGAGGCCAGG - Intergenic
1024264874 7:47598796-47598818 CTGAAGCTGTAGAAGGAGGCAGG - Intergenic
1024527652 7:50362408-50362430 CTGAAGGTGAAAAAGAAGGCAGG - Intronic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1025020674 7:55476919-55476941 CTGGAGATGGAGAATAGGGCAGG - Intronic
1025288500 7:57689189-57689211 CCGAAGAGACAGAAGAAGGCAGG - Intergenic
1025481634 7:60991739-60991761 GTGGAGATGGGGTAGAAGGCAGG - Intergenic
1025607103 7:63047354-63047376 CTGAAGATGGTGAGGGAGGTTGG - Intergenic
1025800676 7:64784207-64784229 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
1026479981 7:70769795-70769817 CCAAAGATGGAGAATAAGCCTGG + Intronic
1028269249 7:88767725-88767747 CTGAAAATGTAGGTGAAGGCTGG - Intronic
1028279837 7:88909427-88909449 CTGAAAAGGCAGAAGATGGCAGG + Intronic
1028965158 7:96793931-96793953 TGGAAGATGGAGAAGAAGCAAGG + Intergenic
1029385730 7:100242336-100242358 CTTAAGATAGAAAATAAGGCCGG + Intronic
1029574966 7:101397364-101397386 AAGAAGATGAAGAAGAAGGAAGG - Intronic
1030064834 7:105651677-105651699 CTAGAGATGGAGAAGCAGGTGGG - Intronic
1030266792 7:107629684-107629706 CTGGAGATGGAGGAAAATGCAGG - Intergenic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030510679 7:110479202-110479224 ATGAGGTTGGAGAAGTAGGCAGG - Intergenic
1030511101 7:110482791-110482813 ATGAGGTTGGAGAAGAAGGCAGG - Intergenic
1031665389 7:124476899-124476921 TTGCAAATGGAGGAGAAGGCAGG + Intergenic
1031912979 7:127536887-127536909 CTGAAGGTGGGGGAGAAGGTTGG + Intergenic
1032448854 7:132009526-132009548 CTGAAGATGGATCACAACGCAGG - Intergenic
1032932820 7:136694118-136694140 CTGAAGAGGAAGATGAATGCGGG - Intergenic
1032960439 7:137027355-137027377 GTGAGGATGGAGAGGAAGGAGGG - Intergenic
1033255613 7:139798985-139799007 CGGCAGGTGGAGAAGGAGGCTGG - Intronic
1033583518 7:142757341-142757363 CTGGAGATGGAGAAAAATGCAGG + Intronic
1033586488 7:142778535-142778557 CTGGAGATGGAGAAAAATGCAGG + Intergenic
1035994248 8:4528203-4528225 CTGAAGATGGAACAGAAAGTTGG - Intronic
1036138054 8:6180471-6180493 CAGAAGGTGGAGAAGACAGCAGG + Intergenic
1036560049 8:9894098-9894120 CTGAGGTAGGAGTAGAAGGCTGG + Intergenic
1036634250 8:10538235-10538257 CTGAAGATGGGGAAGGAAGGGGG - Intronic
1036777830 8:11625671-11625693 CTGAAGACGGTGAGGGAGGCTGG + Intergenic
1038950128 8:32404879-32404901 TTTAAGATGAAGATGAAGGCTGG - Intronic
1039343139 8:36672983-36673005 ATGAGGATGGAAAAGAGGGCTGG - Intergenic
1039386171 8:37137753-37137775 CTGGAGTTGGAGAAAAAGGGAGG - Intergenic
1039612041 8:38927876-38927898 CTGGAGCTGGAGATGACGGCTGG + Intronic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041575835 8:59394393-59394415 TTGAAAATGTAGAAGAATGCAGG - Intergenic
1041709560 8:60881498-60881520 CAGAAGTCGGAGGAGAAGGCAGG - Intergenic
1041751492 8:61265797-61265819 CATAAGATGGGAAAGAAGGCAGG - Intronic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042566597 8:70117964-70117986 CTGAAGAAAGAGCACAAGGCAGG + Intronic
1043059527 8:75482364-75482386 CTAAAAATGGAGCAGAAGGGAGG - Intronic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043590188 8:81822412-81822434 CCTAAGATTGAAAAGAAGGCAGG + Intronic
1043945093 8:86241116-86241138 CTTAAGATGGATAAGAAGAATGG - Intronic
1045330402 8:101151159-101151181 CTGAAGAATGAGAACAAGCCAGG - Intergenic
1045543925 8:103111538-103111560 CTGAAGAAAGATCAGAAGGCTGG + Intergenic
1045578630 8:103453680-103453702 CTGCAGACAGAGAAGAGGGCTGG - Intergenic
1045629695 8:104104013-104104035 CTGAAGATGGAGGAGGAGATGGG + Intronic
1045899144 8:107254813-107254835 CTGATCATGGACAAGCAGGCTGG - Intronic
1045995237 8:108354218-108354240 ATGGAGATAGAGTAGAAGGCTGG + Intronic
1046159806 8:110346327-110346349 ATGAAGCTGGAGAAGATGGTAGG + Intergenic
1046814232 8:118566327-118566349 ATAAAGATGGAGTAGAAGACAGG - Intronic
1046860181 8:119082589-119082611 TTGAAGACGGAGATGGAGGCAGG + Intronic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1046990685 8:120449475-120449497 CTCAAGATGTAGGAGAGGGCTGG + Intronic
1047401723 8:124553815-124553837 CTGAAGATGGTAGAGAAGCCTGG - Intronic
1047970734 8:130082100-130082122 CTGAAGAGGGAGAGGCTGGCAGG + Intronic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048340526 8:133535059-133535081 CTGAGGATGGAGTGGAAAGCGGG + Intronic
1048787835 8:138069686-138069708 CAGAAGATGGAGGAGACGGAGGG + Intergenic
1048837862 8:138538306-138538328 CTGAGAGTGGAGAAGAAGGAAGG + Intergenic
1049034305 8:140062390-140062412 GTGAAGCTGGAAAAGCAGGCAGG - Intronic
1049382163 8:142322350-142322372 CGTAAGATGGGGAACAAGGCAGG + Intronic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1050169589 9:2801496-2801518 ATGAAGATTGAGAATAAGGATGG + Intronic
1050192611 9:3044077-3044099 CAAAGGATGGAGGAGAAGGCAGG - Intergenic
1050271480 9:3950430-3950452 ATGAGGCTGGAGAAGTAGGCGGG - Intronic
1050353456 9:4761756-4761778 CTAAAGATGGAGAAGCAGACTGG - Intergenic
1050465367 9:5917409-5917431 ATGAAGCTGGAGAGGTAGGCAGG + Intronic
1050719321 9:8567368-8567390 CTGAAATTGGAGAAGAGGTCAGG - Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1052349553 9:27444357-27444379 CTGAAGAGGTGGAAGAAAGCAGG - Intronic
1052433198 9:28393591-28393613 CTTAAGATGGAGACGAGGGATGG + Intronic
1052902247 9:33803188-33803210 CTGGAGATGGAGAAAAATGCAGG + Intergenic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053653630 9:40193920-40193942 CTGAGGACAGAGAACAAGGCTGG + Intergenic
1053697694 9:40651791-40651813 GTGGAGATGGGGTAGAAGGCCGG + Intergenic
1053904029 9:42823211-42823233 CTGAGGACAGAGAACAAGGCTGG + Intergenic
1054308985 9:63451199-63451221 GTGGAGATGGGGTAGAAGGCCGG + Intergenic
1054407780 9:64775313-64775335 GTGGAGATGGGGTAGAAGGCCGG + Intergenic
1054440925 9:65259147-65259169 GTGGAGATGGGGTAGAAGGCCGG + Intergenic
1054489351 9:65762339-65762361 GTGGAGATGGGGTAGAAGGCCGG - Intergenic
1054530956 9:66182303-66182325 CTGAGGACAGAGAACAAGGCTGG - Intergenic
1055016955 9:71629056-71629078 TTGAAGATGGAGATGCAGGAAGG - Intergenic
1055237117 9:74136040-74136062 CTAAATATGGAAAAGAAGACAGG - Intergenic
1056236103 9:84596255-84596277 GTGGAGATGGAAAAGAAGACTGG - Intergenic
1056822249 9:89851506-89851528 CTATGGATGGAGAAGAAGCCAGG + Intergenic
1057233061 9:93336735-93336757 CTGAAGCTGGGACAGAAGGCAGG + Intronic
1057252452 9:93514883-93514905 CTGAAGCTGGGACAGAAGGCAGG - Intronic
1057694450 9:97313413-97313435 CTGGAGAGGGGGAGGAAGGCTGG - Intronic
1057716329 9:97498792-97498814 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1057890257 9:98864578-98864600 CTGCAGATGGAGAAGGAAGGAGG - Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059131840 9:111760132-111760154 CTGTAGATAGGGAAGATGGCTGG - Intronic
1059212542 9:112527446-112527468 ATGAAGTTGAAGAAGAAAGCAGG + Intronic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059817742 9:117936989-117937011 TTAAAGATGGAGCAGAAGGGAGG - Intergenic
1059842052 9:118228616-118228638 CTGAAGAGGGAGAAGAAGTTTGG + Intergenic
1060016179 9:120088273-120088295 CTGAGGATGGAGAAAAGGGAAGG + Intergenic
1060125476 9:121040347-121040369 ATGAAGCTGGGGAAGAAGGCAGG + Intronic
1061130451 9:128705208-128705230 CTGCAGATGGAGGCGAAGGAAGG - Intronic
1061709016 9:132474699-132474721 CCAAAGGTTGAGAAGAAGGCAGG + Intronic
1061774148 9:132949413-132949435 CTCAAGAAGGAGAATCAGGCTGG - Intronic
1061875703 9:133542561-133542583 GTGAATATGGAGAAGAATGAGGG - Intronic
1062085212 9:134644612-134644634 CCGAAGATGGAGAAGACAGCAGG - Intronic
1062131589 9:134897185-134897207 CTGGAGATGGAGTGGGAGGCAGG - Intergenic
1062635503 9:137488523-137488545 CAAAGGATGGAGAGGAAGGCAGG + Intronic
1202780073 9_KI270717v1_random:25191-25213 GTGGAGATGGGGTAGAAGGCCGG + Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1186105091 X:6196913-6196935 CTGAGGAGGGAGAGAAAGGCAGG + Intronic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1189414782 X:40804190-40804212 CTGAGGATGGAGAAGAGAGCTGG + Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1192143594 X:68665511-68665533 CTGCAGGTGAAGAAGAACGCTGG + Exonic
1192251994 X:69421491-69421513 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1192318685 X:70071085-70071107 TTAAAAATGCAGAAGAAGGCCGG - Intergenic
1192543004 X:71990896-71990918 TTGAAGATGAAGAACAAGCCTGG + Intergenic
1192709022 X:73560602-73560624 GAGTAGATGGAGAAGAAAGCAGG - Intergenic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1195113456 X:101670264-101670286 GTGAAGATAGAGAAGTAAGCAGG - Intergenic
1195407390 X:104530580-104530602 CTGAAGATGGAGAGCAAGTTTGG - Intergenic
1195457341 X:105083818-105083840 CTAAACATGGAAAAGAAGACCGG + Intronic
1195485483 X:105400056-105400078 ATGAAGCTGGAGAAGTAAGCAGG + Intronic
1195824030 X:108977796-108977818 CTGAAGATAGAGTAGAAGGATGG + Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196050094 X:111295859-111295881 ATGAAAATGGAGAAGAAGAAAGG + Exonic
1196324906 X:114391202-114391224 CAGAAGTTGGAGAAGAAGAGAGG + Intergenic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1196601535 X:117606447-117606469 ATGAAGATAGAGTAGAAGGATGG + Intergenic
1197128885 X:122980626-122980648 CAGAAGATGAAAAAGAAGACAGG + Intergenic
1197764301 X:130049953-130049975 CTTAAAAGGGAGAAGCAGGCTGG + Intronic
1197823131 X:130561643-130561665 ATGAAGCTGGAGAATTAGGCGGG + Intergenic
1197823573 X:130565558-130565580 ATGAAGATAGAGAAGCAGGGAGG + Intergenic
1197839861 X:130734712-130734734 ATCCAGATGGAAAAGAAGGCTGG - Intronic
1198511730 X:137358823-137358845 ATGAAGATGGAGAAGTAGCCAGG - Intergenic
1198787735 X:140308519-140308541 CTGAAGATGAATAAGAAAACAGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199186336 X:144919875-144919897 CTGAAGATGGTGAACGGGGCAGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199257994 X:145739052-145739074 CAGAAGGTGAAGGAGAAGGCAGG - Intergenic
1199670736 X:150146288-150146310 CAGATGCTGGGGAAGAAGGCAGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1201194829 Y:11481703-11481725 GTGGAGATGGGGTAGAAGGCCGG + Intergenic