ID: 1058956248

View in Genome Browser
Species Human (GRCh38)
Location 9:109951515-109951537
Sequence GCCTGAAGTCCGCTAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058956248_1058956251 -9 Left 1058956248 9:109951515-109951537 CCTGCCACTAGCGGACTTCAGGC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1058956251 9:109951529-109951551 ACTTCAGGCCAGACCGTGTTGGG No data
1058956248_1058956250 -10 Left 1058956248 9:109951515-109951537 CCTGCCACTAGCGGACTTCAGGC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1058956250 9:109951528-109951550 GACTTCAGGCCAGACCGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058956248 Original CRISPR GCCTGAAGTCCGCTAGTGGC AGG (reversed) Intronic
903212031 1:21823936-21823958 GACTGAACTCCGCTGGGGGCAGG - Exonic
903222167 1:21875056-21875078 GCCTGGAGTCCTCCACTGGCAGG + Intronic
907397892 1:54204751-54204773 GTGTGAATTCCTCTAGTGGCAGG + Intronic
908037891 1:60075232-60075254 GCTTGAAGTCAGATAGTGGAAGG - Intergenic
919169384 1:193934950-193934972 GCCTGGGGTGCGCTAGAGGCAGG + Intergenic
919350907 1:196452800-196452822 GTCTGAAGTCAGTTAGTGGAGGG + Intronic
922791497 1:228313708-228313730 GCCGGAGGCCCGCTGGTGGCTGG + Intronic
1064622745 10:17230823-17230845 GCGTAAAGCCCTCTAGTGGCGGG + Intronic
1067100034 10:43328102-43328124 GCCTGAAGTCGGCTCATGGTGGG - Intergenic
1076830761 10:132993022-132993044 GCCTGGAGTCCGCCGGGGGCGGG - Intergenic
1085818441 11:79766892-79766914 GCTTGAATTCCTCTAGTGACAGG + Intergenic
1091882814 12:3993171-3993193 GCCTGCATTCCACTAGTGCCTGG - Intergenic
1101377649 12:104184660-104184682 GCCTGAAGTCAGCCTGTGGTGGG - Intergenic
1104347868 12:128018929-128018951 GCCTGAAAGCCCCTAGTGGGAGG + Intergenic
1119899496 14:78247932-78247954 GCATGAAGTCAGCCTGTGGCAGG + Intronic
1124621113 15:31274663-31274685 GCCTGCAGTCCTCTACTTGCAGG + Intergenic
1125605618 15:40938298-40938320 CCCTGAAGGCCACTACTGGCAGG - Exonic
1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG + Intronic
1136695808 16:32080571-32080593 GCCTGATGGCCACTAGTGACTGG - Intergenic
1136796304 16:33023824-33023846 GCCTGATGGCCACTAGTGACTGG - Intergenic
1136873613 16:33830573-33830595 GCCTGATGGCCACTAGTGACTGG + Intergenic
1137577879 16:49615591-49615613 GCCTGAAGTCCCCCAGCTGCTGG + Intronic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1203098561 16_KI270728v1_random:1285483-1285505 GCCTGATGGCCACTAGTGACTGG - Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1150561119 17:66295737-66295759 TCCTGAAGTCCCCTTATGGCTGG - Intergenic
1151352942 17:73542461-73542483 GGCTGGAGTTCGCTTGTGGCAGG - Intronic
1156375883 18:36515033-36515055 GCCTGCAGGCCGCTGGTGGGAGG - Intronic
1167060942 19:47145874-47145896 CCCTGAAGTCTGCTAGGTGCTGG + Intronic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
932777045 2:74534574-74534596 GCCTGAAGTCAGCTCGTCCCAGG + Exonic
936011378 2:108927389-108927411 GCCTGAATTCTTCTAGAGGCAGG + Intronic
939674127 2:145050663-145050685 GCCTGAAGACCTTTAGTGTCTGG + Intergenic
1179088079 21:38238101-38238123 GGCTGAAGTCACCTGGTGGCAGG + Intronic
1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG + Intergenic
1181900782 22:26154142-26154164 GCCTGAAATGCTCAAGTGGCTGG + Intergenic
1183935747 22:41261191-41261213 GCCTGAAGCCCCATAGGGGCTGG + Intronic
950723990 3:14904126-14904148 GGCTGAAGTCACCTGGTGGCAGG + Intronic
953278129 3:41524609-41524631 GCCTGAAGTCAGCCAGAGGCAGG + Intronic
955821519 3:62901054-62901076 GCCTGAGGTCCTATAGTGGGTGG - Intergenic
960642627 3:119842261-119842283 GCCTGAAGCCAGCTAATGGTGGG - Intronic
962481223 3:135800355-135800377 GGCTGATGTGCCCTAGTGGCAGG - Intergenic
962808864 3:138945676-138945698 GCCTGCAGTTCGCTTGTGCCCGG - Exonic
964748257 3:160031798-160031820 GGCTGAAGTTCCCGAGTGGCTGG - Intergenic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
967943045 3:194780908-194780930 GACTCAAGTCAGCTTGTGGCTGG - Intergenic
968505651 4:970178-970200 GCCGGATGCCCGCCAGTGGCAGG + Intronic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
978180037 4:105782695-105782717 GCCTCAGGTCCCCTAGTAGCTGG + Intronic
995536540 5:113142317-113142339 GCCTGAGGACAGCAAGTGGCTGG - Intronic
1001529378 5:172451726-172451748 GCATGAAGGCAGCTATTGGCAGG - Intronic
1006672754 6:35739751-35739773 TCCTGAAGTGAGCTTGTGGCAGG - Intronic
1013359566 6:109382030-109382052 GCCTGGAGTCCACTCGTGGCCGG - Intronic
1017258085 6:152357226-152357248 GCCTGAAGTCACCTAGTGTTGGG + Intronic
1035726739 8:1829406-1829428 GCTTGAAGTCCGCTGAGGGCTGG + Intronic
1045993836 8:108340278-108340300 GCCTGAACTTCCCTAGTAGCTGG - Intronic
1046538222 8:115544231-115544253 GCCTGAAGAAGGCAAGTGGCTGG - Intronic
1046978469 8:120310648-120310670 GCCTGAACTCCATTAGTGACTGG - Intronic
1048843020 8:138581544-138581566 GCTTGAAGACCTCTCGTGGCGGG + Intergenic
1049578360 8:143399947-143399969 GCCTGCAGTCTGCTGGGGGCTGG + Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1061405320 9:130390548-130390570 GCCTGAAGGCCGGGAGTGGGAGG + Intronic
1061713245 9:132502052-132502074 GCAAGAAGTCCGCTACTGTCTGG - Intronic
1190496268 X:51031134-51031156 GCCTGAAGTCAGCAAGTGGTGGG + Intergenic
1191253968 X:58271888-58271910 GCCAGAAGTCCCCCAGTGGATGG - Intergenic
1193270977 X:79530318-79530340 GTCTGAAGTCCGCTGGAGACAGG - Intergenic