ID: 1058956251

View in Genome Browser
Species Human (GRCh38)
Location 9:109951529-109951551
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058956248_1058956251 -9 Left 1058956248 9:109951515-109951537 CCTGCCACTAGCGGACTTCAGGC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1058956251 9:109951529-109951551 ACTTCAGGCCAGACCGTGTTGGG No data
1058956240_1058956251 29 Left 1058956240 9:109951477-109951499 CCTCTGTGTGTCTGTGCCCTGAT 0: 1
1: 1
2: 32
3: 98
4: 443
Right 1058956251 9:109951529-109951551 ACTTCAGGCCAGACCGTGTTGGG No data
1058956244_1058956251 0 Left 1058956244 9:109951506-109951528 CCCTTCTCACCTGCCACTAGCGG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1058956251 9:109951529-109951551 ACTTCAGGCCAGACCGTGTTGGG No data
1058956243_1058956251 1 Left 1058956243 9:109951505-109951527 CCCCTTCTCACCTGCCACTAGCG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1058956251 9:109951529-109951551 ACTTCAGGCCAGACCGTGTTGGG No data
1058956242_1058956251 12 Left 1058956242 9:109951494-109951516 CCTGATTCTTTCCCCTTCTCACC 0: 1
1: 0
2: 4
3: 34
4: 538
Right 1058956251 9:109951529-109951551 ACTTCAGGCCAGACCGTGTTGGG No data
1058956241_1058956251 13 Left 1058956241 9:109951493-109951515 CCCTGATTCTTTCCCCTTCTCAC 0: 1
1: 0
2: 2
3: 57
4: 574
Right 1058956251 9:109951529-109951551 ACTTCAGGCCAGACCGTGTTGGG No data
1058956246_1058956251 -1 Left 1058956246 9:109951507-109951529 CCTTCTCACCTGCCACTAGCGGA 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1058956251 9:109951529-109951551 ACTTCAGGCCAGACCGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr