ID: 1058957591

View in Genome Browser
Species Human (GRCh38)
Location 9:109963587-109963609
Sequence CAGCCCCCATACTGGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058957587_1058957591 6 Left 1058957587 9:109963558-109963580 CCTTTACTCATCTTAGACTCAAG 0: 1
1: 0
2: 1
3: 9
4: 130
Right 1058957591 9:109963587-109963609 CAGCCCCCATACTGGGCCCTGGG No data
1058957586_1058957591 14 Left 1058957586 9:109963550-109963572 CCTATGGGCCTTTACTCATCTTA 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1058957591 9:109963587-109963609 CAGCCCCCATACTGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058957591 Original CRISPR CAGCCCCCATACTGGGCCCT GGG Intronic
No off target data available for this crispr