ID: 1058957707

View in Genome Browser
Species Human (GRCh38)
Location 9:109964375-109964397
Sequence AGGCAGAGGCAGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2455
Summary {0: 3, 1: 5, 2: 35, 3: 281, 4: 2131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058957703_1058957707 -7 Left 1058957703 9:109964359-109964381 CCAAATGGGCTACTGCAGGCAGA 0: 1
1: 0
2: 0
3: 14
4: 109
Right 1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG 0: 3
1: 5
2: 35
3: 281
4: 2131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058957707 Original CRISPR AGGCAGAGGCAGAGGCAGGA AGG Intronic
Too many off-targets to display for this crispr