ID: 1058959029

View in Genome Browser
Species Human (GRCh38)
Location 9:109975425-109975447
Sequence TGGCCTTCACCAGTGTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 1, 2: 36, 3: 114, 4: 469}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058959029_1058959035 19 Left 1058959029 9:109975425-109975447 CCCACCCACACTGGTGAAGGCCA 0: 1
1: 1
2: 36
3: 114
4: 469
Right 1058959035 9:109975467-109975489 AATTCAATGCTAATCTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058959029 Original CRISPR TGGCCTTCACCAGTGTGGGT GGG (reversed) Intronic
900742747 1:4340563-4340585 TGGCCTCCACCAATGTGGATGGG - Intergenic
902446639 1:16470172-16470194 TTGCCCTCCCGAGTGTGGGTGGG + Intergenic
903414733 1:23174377-23174399 TTGCCTCCACCAATGTGGGTGGG - Intronic
904567974 1:31439388-31439410 TGGCAGTAACCAGTGTGGATTGG + Intergenic
904711260 1:32432255-32432277 TTGCCTTCCGCAGTGTGGGTAGG + Intergenic
904906561 1:33901523-33901545 TGGGGTTGCCCAGTGTGGGTGGG + Intronic
905816939 1:40958646-40958668 TGGCTTTTATCACTGTGGGTTGG - Intergenic
905840650 1:41175174-41175196 TTGCCCTCACCAATGTGTGTGGG + Intronic
905987412 1:42299486-42299508 TGTCTTTAACCAGTGTGTGTGGG + Intronic
907600713 1:55766514-55766536 TCGCCTTCCCCAATGTGGGTGGG - Intergenic
907930728 1:58997443-58997465 TGGCCCTCCCCAGTGTGTATGGG - Intergenic
908927504 1:69273954-69273976 TCATCCTCACCAGTGTGGGTGGG - Intergenic
909138613 1:71834363-71834385 TTGACCTCCCCAGTGTGGGTGGG + Intronic
909604289 1:77493192-77493214 CCACCCTCACCAGTGTGGGTGGG + Intronic
909808436 1:79900892-79900914 TGGAACTCACCAGTGTGGGTGGG - Intergenic
910318353 1:85915109-85915131 TTGCCTTTCCCAATGTGGGTGGG + Intronic
910498955 1:87866378-87866400 CTGCCCTCACCAGTGTGGGCAGG - Intergenic
910769681 1:90818351-90818373 TCAGCTTCACCAGTGTGGGTGGG - Intergenic
913096854 1:115526319-115526341 TTTCCTTCACCAATGTGGGAAGG + Intergenic
913145120 1:115981462-115981484 TGCCTTTCACCAGTTTAGGTGGG + Intronic
914200377 1:145479465-145479487 TTGCCCTCCCCAGTGTGAGTGGG - Intergenic
914348233 1:146817947-146817969 TTGGCTTCCCCAGGGTGGGTCGG - Intergenic
914479492 1:148052592-148052614 TTGCCCTCCCCAGTGTGAGTGGG - Intergenic
914920093 1:151840417-151840439 TGGACTTCACCTGTGAGGGCTGG - Exonic
916329718 1:163601026-163601048 TGGCCTTCTCTAGTGTGGGTGGG + Intergenic
916399992 1:164437123-164437145 TTGACTTCTCCAATGTGGGTGGG - Intergenic
916459169 1:165004809-165004831 TGGCCCTCCCCAATGGGGGTGGG - Intergenic
919231266 1:194777937-194777959 CTGCCTTCACCAATGTGGGCAGG + Intergenic
919618275 1:199834900-199834922 TGGCCTTTGCTTGTGTGGGTGGG - Intergenic
920185425 1:204156392-204156414 TGTCCTTCCTGAGTGTGGGTGGG + Intronic
920263867 1:204707602-204707624 TGGTCCCCACCACTGTGGGTGGG + Intergenic
921762654 1:218934439-218934461 TTGCCCTCCCCAGTATGGGTGGG - Intergenic
921853876 1:219959949-219959971 TTGCCCTCACTAATGTGGGTGGG + Intergenic
922882451 1:228991010-228991032 AGCCCTTCACCAGTGACGGTGGG + Intergenic
923095251 1:230770376-230770398 TTGCCCTCCCCAGTGTAGGTGGG - Intronic
923178412 1:231492016-231492038 TGGCCCTCTTCAGTGTGGGTGGG - Intergenic
923536477 1:234856060-234856082 TGGCCCTCTGTAGTGTGGGTGGG - Intergenic
924478095 1:244399103-244399125 TTGCCTTCACCAATGTGGATGGG - Intergenic
1063051369 10:2452928-2452950 TAGCCCTCCCCAATGTGGGTGGG - Intergenic
1063143388 10:3275284-3275306 TGGCCTTCCCCAGGGTGGGTGGG + Intergenic
1063717923 10:8546960-8546982 TCACCCTCACCAATGTGGGTAGG - Intergenic
1063742320 10:8837521-8837543 TGGCCCTCCCCAATGTGGGTGGG - Intergenic
1064638570 10:17393006-17393028 CTGCCCTCACCAGTGTGGGTGGG + Intronic
1065090140 10:22223823-22223845 TTGCCCTCCCCAGTGTGGGCAGG + Intergenic
1065867322 10:29925464-29925486 TGGCCCTCCCCAGGGTGAGTGGG + Intergenic
1066051145 10:31636852-31636874 TGGCCCTCCCTAGTGTGGGTGGG - Intergenic
1066252117 10:33644430-33644452 TGGCCCTCCCCAATGTGGATGGG + Intergenic
1067078418 10:43200934-43200956 AGGCCACCACCACTGTGGGTAGG + Intronic
1067555947 10:47271713-47271735 TGGCCCTTCCCAGTGTGGGTGGG + Intergenic
1069803131 10:71094719-71094741 TGGCCCTCATCAGGGTAGGTGGG - Intergenic
1072447948 10:95515812-95515834 AGGAGTTCACCAGTGTGGATAGG + Intronic
1073830231 10:107375464-107375486 TTACCTTCACCAGTGTGGGCAGG - Intergenic
1074365886 10:112857165-112857187 TTGCCCTCACCAATGTGGGCAGG - Intergenic
1075155927 10:119975733-119975755 TGGCTCTCCCCAGTGTGGGTGGG - Intergenic
1076052996 10:127350041-127350063 TGGTCATGACTAGTGTGGGTTGG - Intronic
1076100068 10:127770096-127770118 TTGCCCTCCCCATTGTGGGTGGG + Intergenic
1076228557 10:128800844-128800866 TTTCCTTCTCCAATGTGGGTGGG - Intergenic
1076338635 10:129727811-129727833 TAGCCTTCAGCTGTGTGGGCTGG + Intronic
1076363007 10:129902895-129902917 TGGCATTTACCAGGCTGGGTAGG - Intronic
1076456943 10:130606710-130606732 AGGCCTACAGCAGTTTGGGTTGG - Intergenic
1077880480 11:6345737-6345759 TGGTATTCACCAGTGTAAGTAGG - Intergenic
1078211408 11:9272783-9272805 TCACCCTCACCAATGTGGGTGGG - Intergenic
1078486788 11:11730768-11730790 TGGCCCTCCCCAGTGTGAGTGGG + Intergenic
1079861923 11:25683796-25683818 TGCCCTCACCCAGTGTGGGTGGG + Intergenic
1080630579 11:34071122-34071144 TGGCCCTTACCCATGTGGGTAGG + Intronic
1080936505 11:36869369-36869391 TGGTCCTCCCCAGTGTAGGTGGG + Intergenic
1081370088 11:42289942-42289964 TTGCCATCTCCAATGTGGGTGGG + Intergenic
1081942821 11:46958915-46958937 TCACCTTCACCAATGTGGGTGGG - Intronic
1082687947 11:56262340-56262362 TGGACTTTTCCAGTTTGGGTTGG + Intergenic
1084145883 11:67265273-67265295 TGGCTTTCCCCACTCTGGGTGGG + Intergenic
1084315405 11:68342735-68342757 TGGCCTCCCCCGGTGTGGGTTGG + Intronic
1084854335 11:71972451-71972473 TGTCCTTCACTAGTGCAGGTTGG + Intronic
1085905304 11:80753485-80753507 TGGCCCTCCCTAATGTGGGTGGG - Intergenic
1086170748 11:83833707-83833729 TGGGCTTCAACATTGTCGGTGGG - Exonic
1087725357 11:101709349-101709371 TTGCCCTCCCCAATGTGGGTAGG - Intronic
1088032131 11:105264056-105264078 TTGCCCTCACTAATGTGGGTGGG - Intergenic
1088235879 11:107721990-107722012 CTGCTCTCACCAGTGTGGGTGGG - Intergenic
1088384545 11:109238967-109238989 TTGCCCTCCCCAATGTGGGTGGG + Intergenic
1089001264 11:115054227-115054249 TCACCCTCCCCAGTGTGGGTGGG - Intergenic
1089011258 11:115133644-115133666 TTGCCTTCACCAATGTGAGTGGG + Intergenic
1089164436 11:116464274-116464296 TCACCCTCACCAATGTGGGTGGG + Intergenic
1089500857 11:118930368-118930390 TGGCCTTCAGGTGTGTGGGTGGG + Intronic
1090843346 11:130511837-130511859 ACGCCCTCACCAGTGTGGGCAGG - Intergenic
1090929410 11:131281941-131281963 TGGCCCTCCCTATTGTGGGTGGG + Intergenic
1091191074 11:133695714-133695736 TGGCCCTCCCCACTGTGGGTGGG + Intergenic
1091670699 12:2450230-2450252 TACACTTCACCAGTGTAGGTAGG - Intronic
1093415668 12:18917745-18917767 CTGCCTTCACCAGTGTGGGTGGG + Intergenic
1095341017 12:41088302-41088324 TGGTCCTCACCAATGTGGCTGGG - Intergenic
1095385460 12:41644868-41644890 TGGGCCTCCCCAGTGTGAGTGGG + Intergenic
1096075335 12:48800438-48800460 TGCCCCTCTCCAGGGTGGGTGGG - Intergenic
1096537697 12:52286062-52286084 TGGCCTTTCCCACTGTGGGGTGG + Exonic
1098392170 12:69981078-69981100 TTGCCTTAACCATTTTGGGTGGG + Intergenic
1099546016 12:83980602-83980624 TGGCTCTCCCCAGTGTGAGTAGG + Intergenic
1099774502 12:87107539-87107561 CTGCCTTCACCATTGTGGATAGG - Intergenic
1100338648 12:93656833-93656855 TGGTCCTCACCAATGTTGGTGGG - Intergenic
1100383600 12:94085055-94085077 TGGCCCTCCCCAACGTGGGTGGG + Intergenic
1100750284 12:97691194-97691216 TTACCCTCCCCAGTGTGGGTGGG + Intergenic
1100782963 12:98048870-98048892 TGGCCCTCCCCAGTATGGATGGG + Intergenic
1100800340 12:98224140-98224162 TCGTCTTCTCCAATGTGGGTGGG - Intergenic
1100906111 12:99301203-99301225 CTGCCCTCACCAGTGTGGATGGG - Intronic
1101036546 12:100713183-100713205 TGGCCTTCTCCAATGTGGGTAGG - Intergenic
1101086856 12:101244883-101244905 TGGCCATCCCCAATGTGGGTGGG + Intergenic
1101190939 12:102331676-102331698 TTGCCTTCCCCAGTATGGTTGGG + Intergenic
1101396391 12:104352134-104352156 TCACCCTCACCAATGTGGGTAGG + Intergenic
1103130542 12:118464737-118464759 TGGCCTTCCTCAAAGTGGGTAGG + Intergenic
1103228475 12:119308056-119308078 AAGCCCTCCCCAGTGTGGGTGGG + Intergenic
1105581913 13:21706074-21706096 TGCCCTTCCCCAGTGTGAGGAGG - Intergenic
1105584544 13:21731843-21731865 TCTGCTTCACCAGTGTGGTTGGG + Intergenic
1105608471 13:21946966-21946988 ATGGCTGCACCAGTGTGGGTTGG - Intergenic
1106364957 13:29069454-29069476 TGGCCTTCCCCAATGTGGGTGGG - Intronic
1106643933 13:31613115-31613137 TTGCCTTCCCCAATGAGGGTGGG - Intergenic
1106877954 13:34095989-34096011 TTGCCCTCACCAATGTAGGTGGG - Intergenic
1107073734 13:36298894-36298916 TTGTCTTCCCCAATGTGGGTGGG + Intergenic
1107445607 13:40467933-40467955 CTGCCCTCACCAGTGTGGGCAGG + Intergenic
1107586751 13:41857890-41857912 TGGCCTTCCTCAATATGGGTGGG + Intronic
1107766651 13:43742523-43742545 TGGCTCTCACCAATGTGAGTGGG - Intronic
1107836635 13:44416947-44416969 TGGCCCTCCCCAGTGTCAGTGGG + Intergenic
1107966560 13:45603218-45603240 TCATCTTCACCAATGTGGGTGGG - Intronic
1108143263 13:47448846-47448868 TTGCCTTCCCCAATGTGGGTGGG + Intergenic
1108258156 13:48630293-48630315 TTGCCTTCCCTAGTGTGGCTTGG - Intergenic
1109314883 13:60738838-60738860 TGGCCCTCCCCAGTGTGGGTGGG + Intergenic
1112824152 13:103372649-103372671 TGTCCCTCCCCAGTGTGGATGGG - Intergenic
1113329774 13:109316882-109316904 TGGCCCTCCCCAGTGTGGGTGGG - Intergenic
1113363042 13:109649114-109649136 GGGCCCTCCCCAGTGTGGGTGGG - Intergenic
1116111139 14:40584183-40584205 TGGCCCTCTCCAATGTGGATTGG - Intergenic
1116135449 14:40917295-40917317 TTGCCCTCCCCAGTGTGTGTGGG - Intergenic
1116278468 14:42869145-42869167 TTGTCTTCTCCAGTGTGGGTGGG - Intergenic
1116409430 14:44604106-44604128 TAGCCCTCTCCAGTGTGAGTGGG - Intergenic
1116586178 14:46707508-46707530 TCACCCTCACCAATGTGGGTGGG - Intergenic
1116707449 14:48320064-48320086 TTGCCCTCCCCAGTGTGGGTGGG - Intergenic
1116769410 14:49109858-49109880 CTACCTTTACCAGTGTGGGTGGG - Intergenic
1116861248 14:49997434-49997456 TTGCCTTCCCCAATGTGAGTGGG + Intronic
1116885118 14:50213177-50213199 TGACCTGCACCAGTGTGGACTGG - Intronic
1119339734 14:73866734-73866756 TGTCCTTCTCTAATGTGGGTGGG + Intronic
1119872002 14:78026080-78026102 TGGCCCTCTCCAATGTGGGTAGG + Intergenic
1120168903 14:81229308-81229330 TTGCCCTCACCAGTGTAGGCAGG + Intergenic
1120374279 14:83681041-83681063 GGGCCTGCAACAGTGTGAGTAGG - Intergenic
1120378887 14:83748024-83748046 TCGCCCTCTCTAGTGTGGGTGGG + Intergenic
1120648267 14:87099364-87099386 TGGCCTTCCCCAATGTAGCTGGG + Intergenic
1120717048 14:87851308-87851330 TGGCTCTCCCCAGTGTGGGCGGG - Intronic
1121222831 14:92299368-92299390 TGACCTTCCCCTGTGGGGGTGGG + Intergenic
1121674834 14:95744049-95744071 TTGCCTTCACCAATGTGGGTGGG + Intergenic
1121969578 14:98344046-98344068 TGTCCTTTACCTGAGTGGGTGGG - Intergenic
1122325855 14:100880307-100880329 TGGCCATCACCAGGCCGGGTGGG + Intergenic
1122417947 14:101559384-101559406 TGCCCCTCACCACTCTGGGTAGG - Intergenic
1124191485 15:27580943-27580965 TCACCCTCACCAGTGTGGGCGGG - Intergenic
1124432198 15:29617388-29617410 TCACCCTCACCAATGTGGGTGGG - Intergenic
1124571149 15:30865151-30865173 TGGCCCTCACCAGTAAAGGTTGG - Intergenic
1124650628 15:31471140-31471162 TGGCTCTCAGCAATGTGGGTGGG - Intergenic
1124657640 15:31522222-31522244 GGGCTTTCACCAATATGGGTGGG + Intronic
1124708434 15:31984756-31984778 AGGCCCTCTCCAATGTGGGTGGG - Intergenic
1125295896 15:38202943-38202965 TTGCCCTCCCCAGTGTGGGTGGG - Intergenic
1126164767 15:45645486-45645508 TTGTCTTCCCCAATGTGGGTTGG + Intronic
1126265846 15:46753063-46753085 TTGCCCTCACCACTGTGGATGGG - Intergenic
1127155755 15:56123042-56123064 TGGTCTTCCCCACTGTGGCTGGG + Intronic
1127553078 15:60060298-60060320 TCACCCTCACCAGTGTGGGTAGG - Intronic
1127553850 15:60067822-60067844 TGGCCCTCCCCAGTGTGGGTGGG - Intergenic
1127696922 15:61459280-61459302 TGGCCATCAGCAGCCTGGGTAGG - Intergenic
1129311559 15:74715356-74715378 TGGCCCTCCCCAATGTGGGTGGG + Intergenic
1129929502 15:79398663-79398685 TGGCCTTCCCCACTGTGGGTGGG - Intronic
1129929529 15:79398841-79398863 TAGCCTTCCCTATTGTGGGTGGG - Intronic
1130011720 15:80157604-80157626 TGGCCCTCAGCACTGTGTGTTGG + Intronic
1130285709 15:82552803-82552825 TTTCCTTCACCAGGGTGGGAGGG - Intronic
1131463251 15:92634795-92634817 TGGCCCTCCCTAATGTGGGTGGG + Intronic
1131997207 15:98144212-98144234 CTGCCCTCACCAATGTGGGTGGG - Intergenic
1132330543 15:101009353-101009375 TTGCATCCACCAGTGTGGGAAGG - Intronic
1133685933 16:8165600-8165622 TCTCCTTCACCAGTGTGCATGGG - Intergenic
1133931940 16:10239781-10239803 CCGCCTTCCCCAGTGTGAGTGGG - Intergenic
1134006580 16:10822239-10822261 GGGCCAAGACCAGTGTGGGTAGG - Intergenic
1134775192 16:16846877-16846899 TGGCCCTCAGCAATGTGGGTGGG + Intergenic
1135253697 16:20923066-20923088 TGGCCCTCCCCAGTGTGAATGGG - Intronic
1135930918 16:26735959-26735981 TGGCCTTCACCAGTGCAGGCAGG + Intergenic
1136009144 16:27351399-27351421 TGGTCTTCTCGAGTGTGGGCAGG - Intronic
1136412560 16:30085863-30085885 TGGCCTGCACCAGTGTGTGTGGG + Exonic
1137768640 16:50996822-50996844 TGGCCTGCTCCAGTGGGGCTGGG - Intergenic
1137802919 16:51277544-51277566 TGGCCTTCACCAATGCAGGTGGG - Intergenic
1137810732 16:51350222-51350244 TGGCCTTCCCCAGTGTGGGTGGG - Intergenic
1138097971 16:54228432-54228454 TTGCCCTCTCCAATGTGGGTCGG - Intergenic
1139361781 16:66403955-66403977 AGGCCTTCTCCAGAGGGGGTGGG - Exonic
1139985805 16:70897598-70897620 TCGGCTTCCCCAGGGTGGGTCGG + Intronic
1141603969 16:85142618-85142640 TGGCCGTCACAGGAGTGGGTGGG - Intergenic
1141827750 16:86493132-86493154 GGGCCTTGGCCAGTGGGGGTGGG + Intergenic
1141930299 16:87197676-87197698 TGGCCCTCCCCAGTGTAGGTGGG - Intronic
1142006553 16:87692118-87692140 TGGCATCCTCCAGGGTGGGTGGG - Intronic
1142133643 16:88442057-88442079 TGACCCTCTCCAGTGAGGGTGGG + Intergenic
1144174438 17:12691443-12691465 GGGCCATCACCTGTGTTGGTCGG + Intronic
1144313847 17:14039906-14039928 TTGCACTCACCAATGTGGGTGGG + Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147197079 17:38774262-38774284 TGGCCCTCCCCAGTGTGGATGGG + Intronic
1149987895 17:61361932-61361954 TTGCCCTCACCATTGTGGGCAGG - Intronic
1151085511 17:71376017-71376039 TTGCCTTCACCAGTGTGGGCAGG - Intergenic
1151334791 17:73433619-73433641 TGACCTTCACAAGTGTACGTGGG + Intronic
1152018487 17:77767893-77767915 CGGCCCCCACCAGTGTGGATGGG - Intergenic
1152143868 17:78555778-78555800 TAGCCCTCCCCAGTGTGGGTGGG + Intronic
1152438065 17:80288223-80288245 TGGCCTTCACCAGCAGAGGTGGG - Exonic
1153077522 18:1182045-1182067 CTGCCCTCACCAATGTGGGTGGG + Intergenic
1153405382 18:4732896-4732918 TGGCCCTCCCTAATGTGGGTGGG - Intergenic
1153432315 18:5031096-5031118 TTGCCCTCACCAATGTGGGCAGG - Intergenic
1153993333 18:10419100-10419122 TGGCCCTCCCCAATGTGTGTGGG + Intergenic
1154946041 18:21162170-21162192 TGGCCTTCCCCATTGTGGGTGGG - Intergenic
1155119677 18:22805498-22805520 CCACCCTCACCAGTGTGGGTGGG - Intronic
1156133422 18:34006393-34006415 TCACCCTCACCAGTGTGGCTGGG + Intronic
1156133584 18:34008041-34008063 TCACCTTCACCAATGTGAGTGGG + Intronic
1156189260 18:34699421-34699443 TTGCCATCCCCAGTGTGAGTGGG - Intronic
1156296818 18:35799746-35799768 TTGCCCTCTCCAGTGTAGGTGGG + Intergenic
1157894520 18:51452305-51452327 TCACCTTCACCAATGTGGGTGGG - Intergenic
1157939297 18:51909490-51909512 TTGCTCTCACCAATGTGGGTAGG + Intergenic
1158018589 18:52813711-52813733 TTGCCATCCCTAGTGTGGGTGGG + Intronic
1158025711 18:52894829-52894851 ATGTCTTCCCCAGTGTGGGTGGG - Intronic
1158122174 18:54060560-54060582 TTACCTTCATCAATGTGGGTGGG - Intergenic
1158332992 18:56383573-56383595 TGGCCTTCTCTAATATGGGTGGG - Intergenic
1158554424 18:58463638-58463660 TGGCCCTCCCCAGTGTGGGTGGG - Intergenic
1158655167 18:59324323-59324345 TGGTCCTCCCCAGTGTGGGTGGG + Intergenic
1159723717 18:71926431-71926453 AGGCTTTCACCATTGAGGGTGGG + Intergenic
1159783323 18:72684575-72684597 TGGCCTTCCTCAGTGTAGGTAGG - Intergenic
1160266858 18:77345729-77345751 TTGCCCTCCCCAGTGTGGGTGGG + Intergenic
1161055418 19:2188492-2188514 GGGCCTGCACCTGTGCGGGTGGG - Intronic
1162550922 19:11357663-11357685 TGGCCTTCACCATGGCGGGAGGG + Exonic
1162782027 19:13011490-13011512 TGGACTTCAGGAGTGAGGGTGGG + Intronic
1163230443 19:15998280-15998302 TGACATTCACCTCTGTGGGTCGG - Intergenic
1165151895 19:33765919-33765941 TGACCTTCCACAATGTGGGTGGG + Intronic
1166343811 19:42153095-42153117 TGGCCTGCACATGTGTGGTTGGG + Intronic
1168525119 19:57082470-57082492 TGGCCCTACACAGTGTGGGTGGG - Intergenic
925561661 2:5202907-5202929 CTGCCTTCCACAGTGTGGGTGGG + Intergenic
925654124 2:6126476-6126498 TGGCCCTCTCCAATGTGTGTGGG - Intergenic
925865831 2:8224979-8225001 TGACCCTCCGCAGTGTGGGTGGG - Intergenic
926954015 2:18273424-18273446 CTGCCATCACCAGTGTGGGCAGG - Intronic
927057833 2:19383667-19383689 TTGCCTTAACTAGTATGGGTGGG - Intergenic
927178363 2:20426090-20426112 TTGTCCTCCCCAGTGTGGGTGGG + Intergenic
927395559 2:22646621-22646643 TGGCCCTCCCCAATGTGGGCAGG + Intergenic
927427787 2:23000339-23000361 TTGTCCTCACCAATGTGGGTGGG - Intergenic
928174307 2:29023628-29023650 TGGGCTGCTCCAGTGGGGGTGGG + Intronic
928370494 2:30736846-30736868 CGGCCTTCACCAGTTGGAGTGGG + Intronic
928456533 2:31427752-31427774 TGGCCTTCACCATGTTGGCTAGG + Intergenic
929549761 2:42882185-42882207 CTGCCCTCACCAATGTGGGTGGG + Intergenic
930430419 2:51268366-51268388 TCGCCTTCACCAATGTGGGTGGG - Intergenic
930631124 2:53756575-53756597 TTGCCCTCACCAATGTGGGCAGG + Intronic
931048060 2:58379486-58379508 TGGCCCTCCCCAGTGTGGGTAGG - Intergenic
931687010 2:64802812-64802834 TTGCCCTCACCAGTGTGGGTGGG - Intergenic
932444366 2:71766156-71766178 TGACCCTCTCCAGTGTGAGTGGG + Intergenic
933567284 2:83966440-83966462 TTGCCCTCTCCAGTGTGGGTGGG - Intergenic
933943757 2:87266851-87266873 TTACCCTCACCAGTGTGGGTGGG + Intergenic
934846250 2:97663148-97663170 TGTCCTTCAGCAGTGGGGCTCGG - Intronic
934962984 2:98694093-98694115 CTGCCTTCACCATGGTGGGTGGG - Intronic
934965738 2:98720294-98720316 TGACCCTCACCAATGTGGGTGGG + Intronic
935125627 2:100220037-100220059 TGGCCCTCCCCACTGTGGGGGGG + Intergenic
935717133 2:105949036-105949058 TGGCCCTCCCCCGTGCGGGTGGG + Intergenic
936336463 2:111594728-111594750 TTACCCTCACCAGTGTGGGTGGG - Intergenic
936659939 2:114531944-114531966 TTGCCCTCCCCATTGTGGGTAGG + Intronic
937376170 2:121337204-121337226 TGGCCTCCAGGAGCGTGGGTGGG + Intergenic
937471852 2:122180747-122180769 TGGCCCTCACCCGTGTGACTGGG - Intergenic
937939829 2:127276269-127276291 TGGACCTCACCAGAGTGGCTGGG - Intronic
938204292 2:129404156-129404178 TTGCCCTCCCCAGTGTGGGCAGG + Intergenic
938308108 2:130268176-130268198 TGGCCCTCACATGTGAGGGTCGG + Intergenic
938447223 2:131388660-131388682 TGGCCCTCACATGTGAGGGTCGG - Intergenic
938609272 2:132930416-132930438 CTGCCCTCCCCAGTGTGGGTAGG + Intronic
939161267 2:138592565-138592587 TGGCCCTCCCCAATATGGGTGGG - Intergenic
939735843 2:145843836-145843858 TTGCCCTCCCCAATGTGGGTGGG + Intergenic
939750020 2:146032253-146032275 TTGCCCTCCCCAGTGTGGGTTGG - Intergenic
939875637 2:147574265-147574287 CTGCCCTCACCACTGTGGGTGGG - Intergenic
940459423 2:153944417-153944439 TGGAGTTCACCTGTGTGGCTTGG + Exonic
945587324 2:211682395-211682417 TTGCCCTCACCAGTGTGGGTGGG - Intronic
946725781 2:222659885-222659907 TGGCCCTCCCCAATGTGGGTAGG - Intergenic
946791503 2:223305102-223305124 TGTCCCTCCCCAGTGTGAGTGGG + Intergenic
946937709 2:224738610-224738632 TGGCCTTCTCAAATGTGTGTGGG - Intergenic
947075998 2:226346714-226346736 TGGTCCTCACCACTGTGGGTGGG + Intergenic
947759302 2:232591962-232591984 TCACCCTCACCAGTGTAGGTGGG + Intergenic
948132996 2:235614607-235614629 AGGCCTGCAGGAGTGTGGGTTGG + Intronic
948533303 2:238627598-238627620 TGGCCCTCCCCAGTGTGGGTGGG + Intergenic
948704944 2:239784232-239784254 TTTCCCTCCCCAGTGTGGGTGGG - Intronic
948881548 2:240860242-240860264 TGGCCTACACCAGTCTAGCTTGG - Intergenic
1169082057 20:2803561-2803583 TGGCCTCCACCAGTCTAGCTTGG - Intergenic
1170120277 20:12904026-12904048 TTGCCCTCTCCAGTGTGGGTAGG + Intergenic
1170472939 20:16686270-16686292 TGGCTCTCTCCAGTGTGAGTAGG + Intergenic
1170773217 20:19352106-19352128 TGGCCTGAACCATTGTCGGTGGG + Intronic
1170947629 20:20905820-20905842 CGGCCCTCCCCGGTGTGGGTGGG - Intergenic
1171169547 20:23003158-23003180 TGGCCCTTTCCAATGTGGGTGGG - Intergenic
1171220037 20:23387945-23387967 TTGCCCTCCCCAATGTGGGTGGG + Intronic
1171231030 20:23485291-23485313 CTGCCCTCACCAGTGTGGATGGG - Intergenic
1171721302 20:28565753-28565775 TTGCCCTCCCCAGTGTGAGTGGG - Intergenic
1171785498 20:29460114-29460136 TTGCCGTCCCCAGTGTGAGTGGG - Intergenic
1171862816 20:30417071-30417093 TTGCCCTCTCCAGTGTGAGTGGG + Intergenic
1173037606 20:39427747-39427769 TTGCCCTCTCCAATGTGGGTGGG - Intergenic
1173176948 20:40771770-40771792 TGGCCTGCTCCAGTTTGGGCTGG - Intergenic
1173291214 20:41716923-41716945 TGGCTCTCCCCAGTGTGAGTGGG - Intergenic
1173452778 20:43180039-43180061 TGGCCCTCCCCAATGTGGGTGGG + Intronic
1173931484 20:46823804-46823826 TGGCCCTCCCTAATGTGGGTAGG - Intergenic
1173942822 20:46926549-46926571 TGGCCCTCCCCAAAGTGGGTGGG - Intronic
1175169158 20:57067818-57067840 TGGCCCTCCCCAATGTGGGTGGG - Intergenic
1175284787 20:57830769-57830791 TGGCACTCCCCAGGGTGGGTGGG - Intergenic
1175719972 20:61280014-61280036 TTGCCTGCAGCTGTGTGGGTGGG + Intronic
1176286908 21:5023175-5023197 CCGCCTTCCCCAGTGTGGATCGG - Intronic
1176792221 21:13330998-13331020 TTGGCTTCCCCATTGTGGGTGGG - Intergenic
1177780652 21:25619404-25619426 TTGCTTTCCCCAGTGTGGGTGGG - Intergenic
1177910638 21:27026646-27026668 TGGCCCTCCTCAGTGTAGGTGGG + Intergenic
1177991616 21:28041859-28041881 TTGGCTTCCCCATTGTGGGTGGG - Intergenic
1178195034 21:30334950-30334972 TGGCCCTCTCCAATGTGGATGGG - Intergenic
1178257451 21:31067389-31067411 TTGCCTTCCACAATGTGGGTGGG + Intergenic
1178388742 21:32181080-32181102 TGGCCCTCCCCAGTGTGAGTAGG + Intergenic
1178634709 21:34292063-34292085 TGGCACTCCCCAATGTGGGTGGG + Intergenic
1178803675 21:35820346-35820368 TGGCTCTCCCCATTGTGGGTGGG + Intronic
1179020493 21:37636184-37636206 CTGCCCTCACCTGTGTGGGTGGG - Intronic
1179376875 21:40857515-40857537 TGGCCCTCTCCATTGTGGGTGGG - Intergenic
1179484448 21:41700766-41700788 TGGCCCTCCCCAGTGTAGGTGGG - Intergenic
1179597980 21:42455915-42455937 CGGCCCTCCCCAGGGTGGGTGGG - Intergenic
1179870273 21:44240300-44240322 CCGCCTTCCCCAGTGTGGATCGG + Intronic
1182933658 22:34199256-34199278 TGGCTCTCCCCAGTGTGGGTGGG + Intergenic
1182941204 22:34279439-34279461 TGGCCCTCCCCAGAATGGGTGGG - Intergenic
1183024234 22:35052153-35052175 TGGCCTTCACCAATGAGGGCAGG + Intergenic
1183144084 22:35973408-35973430 TGGTTGTCACCAGTGTGGCTTGG - Intronic
1184269953 22:43374381-43374403 TGGCCCTCCCCAATGTGGGCAGG - Intergenic
1184366618 22:44055883-44055905 TGGCCCTCCCCAGTGCGGATAGG - Intronic
1184694485 22:46131878-46131900 TCGCCTTCAGGAGTGTGGGTCGG + Intergenic
1184883518 22:47327594-47327616 TGGCCCTCTCCAATGTGTGTGGG - Intergenic
1185059385 22:48598223-48598245 TGGCCTTCCATACTGTGGGTGGG - Intronic
1185114577 22:48924553-48924575 TGGCCCTCCCCAGGGTGGGTGGG + Intergenic
1185136225 22:49074581-49074603 TGGCAGTCCCCAGTGTGGGGAGG + Intergenic
1185164681 22:49254163-49254185 TGGCCCTCCCCAGTGTGCGTGGG + Intergenic
949400868 3:3664235-3664257 TGGTCTTCCTCAATGTGGGTGGG - Intergenic
950333320 3:12174419-12174441 AGGCCCTTACCAGTGTGGCTAGG - Intronic
951391159 3:22105740-22105762 TGGCCCTCCCCAATGTTGGTAGG - Intronic
951986653 3:28628601-28628623 TGGCTTTCTCCAGTGGGGGTGGG + Intergenic
952004175 3:28822954-28822976 TGCCCTTACCCAATGTGGGTGGG - Intergenic
952214164 3:31259492-31259514 TTACCCTCACCATTGTGGGTAGG - Intergenic
953166253 3:40467538-40467560 TGACCTTCACCAATGCAGGTGGG - Intergenic
953260987 3:41338963-41338985 TGGCCCTCCCCAGAGTAGGTGGG - Intronic
953492339 3:43362669-43362691 AGGCCTGCACCAGGGTGGGCAGG - Intronic
953621540 3:44536940-44536962 TGGCCCTCCCCAGTGTGGGTGGG - Intergenic
954631705 3:52051252-52051274 TGGCCAAGCCCAGTGTGGGTAGG + Intronic
954922388 3:54203167-54203189 TGGCTCTCCCCAATGTGGGTGGG + Intronic
956211420 3:66805313-66805335 TGGCCCTCCCCAGTGTGAATGGG - Intergenic
956350083 3:68324972-68324994 TGGCCTTGTCTAATGTGGGTGGG + Intronic
956644007 3:71438894-71438916 TGGTCTCCACCAGTGGGGTTGGG - Intronic
956845311 3:73177035-73177057 TGGCCCTCTCTAGTGAGGGTGGG + Intergenic
957326739 3:78705702-78705724 ATGCCTTCACCAATGTGGGCTGG + Intronic
957448770 3:80348819-80348841 TTACCCTCCCCAGTGTGGGTGGG + Intergenic
957630303 3:82709489-82709511 TTCCCTTCACTATTGTGGGTGGG + Intergenic
957723255 3:84031814-84031836 TGGCCTGCATCTGCGTGGGTGGG + Intergenic
958414662 3:93859509-93859531 GTGCCCTCACCAATGTGGGTTGG + Intergenic
961026291 3:123560858-123560880 CAGCCTTCAGCAGTGTGGCTGGG - Intronic
961363317 3:126381872-126381894 TGGCCTTCACAAGTGTACTTAGG + Intergenic
962156462 3:132953652-132953674 TGCCCTCCCCCAATGTGGGTGGG + Intergenic
963997988 3:151733223-151733245 TCACCTTCCCCAGTGTGGGTGGG - Intergenic
964297956 3:155254447-155254469 TCACCCTCATCAGTGTGGGTAGG + Intergenic
964679539 3:159322489-159322511 TGGCATTCAGCACTCTGGGTGGG - Intronic
965374527 3:167906877-167906899 TTGCCCTCACCAATGTGGGCAGG - Intergenic
965422629 3:168480889-168480911 TCGCCTTCACCAATGTGGATGGG - Intergenic
966553227 3:181229471-181229493 TGGCCTTGATGAGGGTGGGTGGG + Intergenic
966885944 3:184378227-184378249 GGGCCTTCACCAGTGTCTGGTGG - Intronic
967120713 3:186380400-186380422 TCACCCTCACCAATGTGGGTGGG - Intergenic
968073885 3:195805297-195805319 TGGCGATCACCAGAGTGGCTGGG - Intronic
968223056 3:196952769-196952791 TCAGCTGCACCAGTGTGGGTGGG + Intronic
968878090 4:3284859-3284881 TGACCTTCCACGGTGTGGGTGGG + Intergenic
968884496 4:3320354-3320376 TGCTCTGCTCCAGTGTGGGTGGG - Intronic
969055118 4:4396839-4396861 TGGCATTCAGCAGTGGGGGTGGG + Intronic
969119283 4:4895810-4895832 CTGCCTTCACCAGTGTGTGCGGG + Intergenic
969119552 4:4897963-4897985 TGGGATCCACCAGTTTGGGTTGG + Intergenic
969364333 4:6685393-6685415 TGACCTTCCATAGTGTGGGTAGG - Intergenic
969503876 4:7571462-7571484 TGGCCATGCCCCGTGTGGGTGGG + Intronic
969681536 4:8645884-8645906 TGGCTGTCACCAGTGTGGAAGGG - Intergenic
969948053 4:10805177-10805199 TTGCCCTCACTAATGTGGGTGGG + Intergenic
970253434 4:14141557-14141579 TCACCCTCCCCAGTGTGGGTGGG + Intergenic
970524283 4:16915599-16915621 TGGCCTTTCCCAATGTGGGTGGG + Intergenic
970566819 4:17339734-17339756 TTGCCCTCCCCAGTGTGAGTGGG - Intergenic
971697037 4:29918997-29919019 TGGCCCTCTGCAGTGTAGGTGGG + Intergenic
972080830 4:35146795-35146817 TTGCCTTCCCCAATGTGTGTGGG + Intergenic
972238083 4:37157551-37157573 TGGCCCTCTCCAGTGTGGGTGGG + Intergenic
972403075 4:38723278-38723300 TGGCCTTCCCTACTGGGGGTTGG + Intergenic
972499060 4:39660961-39660983 TTGCCTTCCCTAATGTGGGTGGG - Intergenic
972877042 4:43375179-43375201 TTGCCCTCACCAATGTGGGCAGG - Intergenic
972987572 4:44783291-44783313 TGGCCCTCACCAATGTAGATGGG + Intergenic
973136565 4:46715577-46715599 TTGCCCTCCCCAGTGTGGGTGGG + Intergenic
973304115 4:48624797-48624819 TTGCCTTCCCCTATGTGGGTAGG + Intronic
973658712 4:53079313-53079335 TCGCCCTCACCAGTGGGAGTGGG - Intronic
973715352 4:53670510-53670532 CCACCTTCATCAGTGTGGGTAGG + Intronic
976121589 4:81789404-81789426 TGGCCTTCCATAATGTGGGTGGG - Intronic
976499532 4:85771464-85771486 TGGCCCTCACCTATGTGAGTGGG - Intronic
976541794 4:86285984-86286006 TTGCCCTCACTAATGTGGGTGGG - Intronic
976568026 4:86575032-86575054 TTGCCCTTCCCAGTGTGGGTGGG + Intronic
976971552 4:91108919-91108941 TGCCCTCACCCAGTGTGGGTGGG + Intronic
977089185 4:92649461-92649483 CTGCCCTCACCAATGTGGGTGGG - Intronic
977089463 4:92652209-92652231 CTGCCCTCACCAGTGTGGGCAGG - Intronic
977337804 4:95720192-95720214 TGGCCCTCCCCAATGGGGGTGGG - Intergenic
978485940 4:109253477-109253499 TGGCCTTCCCCGATGTGGGTGGG - Intronic
978802580 4:112769739-112769761 TGGCCCTCCCCAGTGTGGGTAGG + Intergenic
979279169 4:118845709-118845731 TATCCTTCCCCAATGTGGGTGGG + Intergenic
979775029 4:124579787-124579809 TGGGCATAATCAGTGTGGGTAGG + Intergenic
980746171 4:137019652-137019674 TGGCTTTCTCCAATGTGAGTAGG - Intergenic
980828873 4:138105519-138105541 TGGCCCTCGTCAGTGTTGGTGGG + Intergenic
980907604 4:138963361-138963383 TCACCGTCATCAGTGTGGGTGGG - Intergenic
981634743 4:146863911-146863933 TGGCCTTCCCCTATGTGGATGGG - Intronic
981698780 4:147585338-147585360 ATTCCTTCCCCAGTGTGGGTGGG - Intergenic
981909503 4:149962457-149962479 TTGCCCTTCCCAGTGTGGGTGGG + Intergenic
982391433 4:154868567-154868589 TTGCCCTCCCCACTGTGGGTGGG + Intergenic
984330045 4:178303098-178303120 TTGCCCTCACCAATATGGGTGGG + Intergenic
985311433 4:188604158-188604180 TTGCCCTCACCAATGTGGGCAGG + Intergenic
985390840 4:189490705-189490727 TGACCCTCACCGGTGTGGGTGGG + Intergenic
985390855 4:189490765-189490787 TGGCCCTCACTGGTGTAGGTGGG + Intergenic
985390871 4:189490825-189490847 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985390880 4:189490855-189490877 TGGCCCTCACTGGTGTGGGTGGG + Intergenic
985390888 4:189490885-189490907 TCGCCCTCACTGGTGTGGGTGGG + Intergenic
985390912 4:189490975-189490997 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985390927 4:189491035-189491057 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985390957 4:189491155-189491177 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985390981 4:189491245-189491267 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985390998 4:189491305-189491327 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985391028 4:189491425-189491447 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985391045 4:189491485-189491507 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985391062 4:189491545-189491567 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985391079 4:189491605-189491627 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985391125 4:189491785-189491807 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985391142 4:189491845-189491867 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985391167 4:189491935-189491957 TGACCCTCACTGGTGTGGGTGGG + Intergenic
985520344 5:371199-371221 TGGTCTTCCCCAGTGTGGCTGGG - Intronic
986024880 5:3841436-3841458 TGGCCTGCAACAGTGGGTGTGGG + Intergenic
986075276 5:4330502-4330524 TTGCCTTCCACAATGTGGGTGGG + Intergenic
987248817 5:16078706-16078728 GGGCCTTCCCCAGTGAGGGATGG + Intronic
988150877 5:27378045-27378067 TTGCCTTCAGTAATGTGGGTGGG - Intergenic
988220810 5:28344817-28344839 TTGCCTTCCCCAATGTGGGTGGG - Intergenic
988582757 5:32482553-32482575 TGGCTCTCCCAAGTGTGGGTGGG - Intergenic
988648156 5:33118997-33119019 TTGCCTTCTCCAGTGTGGGTGGG + Intergenic
989511882 5:42297604-42297626 TGCCCTTGACCAGGTTGGGTAGG - Intergenic
990598061 5:57330923-57330945 TGGCCCTCCCCAATGTGGGTGGG - Intergenic
991015400 5:61926590-61926612 TCCCCCTCACCAATGTGGGTAGG + Intergenic
991554311 5:67878023-67878045 TTGTCCTCCCCAGTGTGGGTAGG + Intergenic
992467867 5:77024945-77024967 TGGCCCTCCCCAATGTGGATGGG + Intergenic
993018517 5:82563722-82563744 TGGCTTGCCCCAGTGTGGGTTGG - Intergenic
993256243 5:85593787-85593809 CTGACTTCACCAGTGTGGGCTGG + Intergenic
993593851 5:89828110-89828132 TGGCATTCTGCAGTGCGGGTGGG + Intergenic
993596346 5:89861047-89861069 TCACCTTCACCAATGTGGATAGG + Intergenic
993728520 5:91395775-91395797 TGGGCCTCCCCAGTGTAGGTGGG - Intergenic
993888916 5:93448798-93448820 TGGCCCTCCCTGGTGTGGGTGGG - Intergenic
994569041 5:101489768-101489790 CTGCCCTTACCAGTGTGGGTGGG + Intergenic
995090850 5:108174595-108174617 TGGCCTTAATCAGTGTGTTTAGG + Intronic
995137250 5:108693056-108693078 TGGCTCTCCCCAGTGTGGATAGG - Intergenic
995405380 5:111788842-111788864 TTGCCTTCCCTAATGTGGGTGGG + Intronic
995629568 5:114118608-114118630 CTGCCTTCCCCAGTGTGGGTGGG - Intergenic
996400173 5:123053792-123053814 TTGCCCTTCCCAGTGTGGGTGGG - Intergenic
996480237 5:123967551-123967573 TTGCCCTCACCAATGTGGGCAGG + Intergenic
996511276 5:124318867-124318889 TGGCCCTTTCCAATGTGGGTGGG - Intergenic
996742786 5:126816965-126816987 TGTCCTTCACCCTTGAGGGTAGG - Intronic
996793860 5:127322621-127322643 TGGCCTTCACCAGTGTTTGCTGG + Intronic
996959133 5:129223184-129223206 TTGCTCTCTCCAGTGTGGGTTGG + Intergenic
997060518 5:130496149-130496171 TTGCCTTCCCCAATGTGGGTGGG - Intergenic
997098555 5:130941870-130941892 TTGCCCTCCCCAGTGTGGATAGG + Intergenic
997207926 5:132060889-132060911 TGGCCTGCAGCAGTGAGGGGTGG + Intronic
997261821 5:132471111-132471133 TGGCCTTTAGCACTGTGGGAAGG + Intronic
997777847 5:136627515-136627537 TGGCCCTCACCAATATGGGTAGG + Intergenic
997850567 5:137329095-137329117 TGGCCCTCTCCAATGTGGGTGGG + Intronic
998858716 5:146422259-146422281 TGGCCCTCCCCAATGTGGGTAGG + Intergenic
998916924 5:147023783-147023805 TGACCCTCACCAATGTGGGCTGG + Intronic
999315023 5:150578011-150578033 TGGCCCTCGCTAATGTGGGTGGG - Intergenic
999545635 5:152625606-152625628 AGGCCCTCCTCAGTGTGGGTGGG + Intergenic
1000320082 5:160127539-160127561 TGGCCCTCAGCAGTGTGGGTGGG + Intergenic
1000399057 5:160806100-160806122 TGGCTGTCCCCAGTGTGGGTGGG - Intronic
1000429408 5:161133591-161133613 TTGCCCTCTCCAATGTGGGTGGG - Intergenic
1001339728 5:170832159-170832181 TGGCCCTCACCAATGTGGGTGGG - Intergenic
1001832739 5:174803232-174803254 CTGCCCTCACCAGTGTGGGGGGG + Intergenic
1002371361 5:178757592-178757614 TGGCCCTCACCAGTGTGGGCGGG + Intergenic
1002983548 6:2165501-2165523 TGGCCCTCCCTAATGTGGGTGGG - Intronic
1003023407 6:2531322-2531344 TGGCCCTCCCCAGTGTGGGTGGG - Intergenic
1003232600 6:4268136-4268158 TGGCCTTCCCCAATGAGGGGGGG + Intergenic
1003243423 6:4364244-4364266 TCATCTTCACCAGTGTAGGTAGG - Intergenic
1003403597 6:5810446-5810468 GGGCCCTCCCCAGTGTGTGTGGG + Intergenic
1003665406 6:8107069-8107091 TCACCCTCACCAGCGTGGGTGGG + Intergenic
1003769854 6:9288258-9288280 TCACCCTCACCAATGTGGGTGGG + Intergenic
1003820398 6:9890018-9890040 TAGCCTTCGCCAGTGTGGGTGGG + Intronic
1004687491 6:17961258-17961280 TGGACTTCACTAGTGTGGGCTGG + Intronic
1004721589 6:18272482-18272504 TGGCACTCCCCAGTGTGGATGGG + Intergenic
1005021006 6:21418684-21418706 TGGCCCTCCCCTGTGTGGGCTGG - Intergenic
1006239612 6:32665699-32665721 TGGCAGTCACCAGTTTGGGCAGG + Intronic
1007763545 6:44148239-44148261 TGGCCTCCACCTTTGTGGGAGGG - Exonic
1008092179 6:47305165-47305187 TGGCCATCACCAGTGCTGGTTGG - Intronic
1008408557 6:51146257-51146279 TTGCCCTCACCAGTGTGAGTGGG + Intergenic
1008831342 6:55766492-55766514 TGGCCTTATCCAGTGTGTTTTGG + Intronic
1008933388 6:56963257-56963279 TGGCCTTCATTAATCTGGGTAGG - Intronic
1009562843 6:65271432-65271454 TGGCCCTCCCCAGTGTGGTTGGG - Intronic
1009581183 6:65535753-65535775 TGGCCTTTCCTAATGTGGGTGGG - Intronic
1010662980 6:78592806-78592828 TAGTCTTCCCCAATGTGGGTGGG - Intergenic
1010918480 6:81650377-81650399 GTGCCTTCACCAATGTGGGTGGG + Intronic
1011652114 6:89516209-89516231 TGGCCCTCCCCAGTGTGGATGGG + Intronic
1011889799 6:92143519-92143541 TGGTCCTCCCCAGTGTGGGTGGG - Intergenic
1011907452 6:92389334-92389356 TGGTCCTCACCAGTGTGGCTGGG - Intergenic
1012111762 6:95244037-95244059 TCACCTTCACCAAAGTGGGTGGG + Intergenic
1013176498 6:107681964-107681986 TGGTCCTCCCCAGTGTGAGTGGG - Intergenic
1013222213 6:108088465-108088487 TTGCCTTTCCTAGTGTGGGTGGG + Intronic
1013275818 6:108583940-108583962 GGTCCTTCAGCAGTATGGGTTGG + Intronic
1013427032 6:110021576-110021598 TTGACCTCCCCAGTGTGGGTGGG + Intergenic
1014178703 6:118359397-118359419 CTGCCTTTACCAGTGTGGGTGGG - Intergenic
1014363911 6:120516313-120516335 TTGCTATCCCCAGTGTGGGTGGG + Intergenic
1014454266 6:121619220-121619242 TTGCCCTCCCCAGTGTGGTTGGG - Intergenic
1014638280 6:123876747-123876769 TGGCCCTCCCCAATGTGGGTGGG - Intronic
1015177411 6:130325478-130325500 TGGCCCTCACGAGTGTGGGTGGG - Intronic
1015661021 6:135573669-135573691 TTGCCCTCCCCAGTGTGGGTGGG - Intergenic
1015752340 6:136573155-136573177 TGGCCCTCTCCAATGTGGGCAGG + Intronic
1015838933 6:137455230-137455252 TTGCCCTCCTCAGTGTGGGTAGG - Intergenic
1015927154 6:138322105-138322127 TGGCCCTCCCTAATGTGGGTGGG + Intronic
1016158999 6:140852566-140852588 TGGCCATCCCCAGTGTGAGTGGG - Intergenic
1016526275 6:145005083-145005105 TCACCCTCACCAATGTGGGTAGG + Intergenic
1016540201 6:145156203-145156225 TGCCATTCTCCAGTGTAGGTGGG + Intergenic
1016661486 6:146586076-146586098 TGGCCATCCCCAATGTAGGTGGG + Intergenic
1016795832 6:148116198-148116220 GTGCCCTCATCAGTGTGGGTGGG - Intergenic
1017386441 6:153890222-153890244 AGGCCTTCACCCTTCTGGGTGGG + Intergenic
1017516450 6:155160376-155160398 TTGCCTTCCCTAATGTGGGTGGG - Intronic
1018631370 6:165825740-165825762 TGTCCTTCAGCAGTGGGAGTGGG + Intronic
1018881073 6:167881661-167881683 TAGCCTTCAGCAGTTAGGGTAGG - Intronic
1018977413 6:168575908-168575930 TGGCCTTCACCTGGGTGCTTGGG - Intronic
1019062763 6:169268252-169268274 TGGTCGTCCCCAGTGTGGGTGGG - Intergenic
1020843608 7:13254526-13254548 TTGCCCTCCCCAGTGTGGGTGGG + Intergenic
1021463186 7:20912017-20912039 TTGCCCTCCCCAGTGTGGGTGGG - Intergenic
1021920749 7:25482456-25482478 CTGCCCTCGCCAGTGTGGGTGGG - Intergenic
1022665005 7:32402546-32402568 TCACCCTCACCAATGTGGGTGGG - Intergenic
1023849258 7:44141071-44141093 TGGCCTGCAACACTGTGAGTAGG + Exonic
1024049026 7:45606307-45606329 TGGCCTTTGCTGGTGTGGGTGGG + Intronic
1024332451 7:48169748-48169770 TGGCCCTCCCTAGTGTGAGTGGG + Intergenic
1026803070 7:73411936-73411958 AGGCCTCCCCGAGTGTGGGTGGG - Intergenic
1029409182 7:100397921-100397943 TGGGCCTCCCCAGGGTGGGTTGG + Intronic
1030166620 7:106562060-106562082 TGGCCCTCCCCAATGTGTGTGGG + Intergenic
1030793829 7:113762390-113762412 TGGCCTTTTCCAGTGTGAGGAGG + Intergenic
1031768062 7:125806208-125806230 TTGCCTTCACCAATGTGGGTGGG + Intergenic
1031818208 7:126466769-126466791 ACCCCTCCACCAGTGTGGGTGGG - Intronic
1032703791 7:134405018-134405040 CTGCCTGCACCAGTGTGGGAAGG + Intergenic
1032857453 7:135846991-135847013 GGGCCTTCCCCACGGTGGGTGGG - Intergenic
1034255091 7:149720471-149720493 TGGCCTTGCCCAGTCTGGGCCGG - Intronic
1034959546 7:155356503-155356525 TGGCCCTCCACAGCGTGGGTGGG - Intergenic
1035702342 8:1646152-1646174 ATGCTTTCCCCAGTGTGGGTGGG + Intronic
1035924153 8:3709555-3709577 TGGCTCTCCCCAGTGTGGGTGGG + Intronic
1036060885 8:5318988-5319010 TGGTCTTCACAGGTGTGAGTAGG + Intergenic
1036121215 8:6019957-6019979 TGGCCTCCAGCAGTGGAGGTGGG + Intergenic
1036153523 8:6320609-6320631 TGGCCCTCTAAAGTGTGGGTGGG - Intergenic
1037020643 8:13966097-13966119 TGGCCCTCCCCAGTGTGAGTGGG - Intergenic
1037058962 8:14482686-14482708 TGGCCCTCCCCAATGAGGGTGGG + Intronic
1037432247 8:18826020-18826042 TGGCCCTCCCCAATGTAGGTGGG + Intronic
1037640074 8:20734319-20734341 TGGCTTTTACCAATGTCGGTAGG + Intergenic
1038610415 8:29055619-29055641 TGGCCCTCACCATTGTGTGTTGG + Intronic
1039094303 8:33866856-33866878 TGGCCCTCAGCAATGTGGGTGGG + Intergenic
1039575491 8:38620465-38620487 TGGCCCTCCCCTGTGTGAGTGGG + Intergenic
1040575507 8:48647947-48647969 AGGCCTGCACGGGTGTGGGTGGG + Intergenic
1040744557 8:50625616-50625638 TTGACTTCACAAGTGTGAGTGGG - Intronic
1040828050 8:51645251-51645273 TGGCTGTCCCTAGTGTGGGTGGG - Intronic
1040955277 8:52973792-52973814 CTGCCATCACCAGTGTGGGATGG + Intergenic
1041224228 8:55682832-55682854 TGTCCCTCCCCAGAGTGGGTGGG - Intergenic
1041450563 8:58002120-58002142 AGGCCCTCCCCAATGTGGGTGGG - Intronic
1041473925 8:58241464-58241486 TTGTCCTCCCCAGTGTGGGTAGG - Intergenic
1041508222 8:58625085-58625107 TTGCCCTCCCCAATGTGGGTGGG + Intronic
1041657074 8:60363532-60363554 TTGCCCTCACCAGTGTGGGTGGG + Intergenic
1041799520 8:61784091-61784113 TGGCCCTCCCCAGTGTAGGTGGG - Intergenic
1042204009 8:66310186-66310208 TTGCCCTCCCCAGTGTGGATGGG + Intergenic
1043270508 8:78327548-78327570 CGCCCTTCATCCGTGTGGGTGGG + Intergenic
1043511710 8:80956725-80956747 TGGCCCTCCGCAGTGTGGCTGGG - Intergenic
1044556071 8:93563341-93563363 TCTCCTTCACCAATGTGGTTGGG - Intergenic
1044560847 8:93610507-93610529 TCACCCTCACCAATGTGGGTAGG - Intergenic
1044968471 8:97596509-97596531 TTGCCTTCCCCAATGTAGGTGGG - Intergenic
1045894466 8:107197397-107197419 TTGCCCTCACCAGTGTGGATGGG - Intergenic
1047174179 8:122524739-122524761 TTGCCCTCCCCAGTGTCGGTGGG + Intergenic
1047624954 8:126647092-126647114 TTGCCCTCACCAGTGTGGATGGG - Intergenic
1047798022 8:128277825-128277847 TTGTCTTCAGCTGTGTGGGTGGG - Intergenic
1048447599 8:134503612-134503634 TGGCCCTCCCTAGTGTGGGTGGG + Intronic
1048590509 8:135816850-135816872 TGGCCCTCCCCAGTGTGGGCGGG + Intergenic
1048757003 8:137750636-137750658 TTGCTTTCCCCAATGTGGGTGGG - Intergenic
1049185672 8:141251378-141251400 TGGGCTGGACCAGTGTGGGAAGG - Intronic
1049662392 8:143825347-143825369 TGGCCTTCCCCAGTGCAGCTGGG - Intronic
1050178183 9:2891210-2891232 TTGCCCTCCCCAGTGTGGGTGGG - Intergenic
1050311450 9:4357290-4357312 TGCCCCTCCCAAGTGTGGGTGGG + Intergenic
1050355225 9:4776534-4776556 TCTCCCTCACCAATGTGGGTGGG + Intergenic
1051235069 9:14990976-14990998 TTACCCTCACCAATGTGGGTGGG + Intergenic
1051434245 9:17013964-17013986 TGCCCTCCCCAAGTGTGGGTAGG + Intergenic
1052518554 9:29513658-29513680 TGACCCTCCCCACTGTGGGTGGG + Intergenic
1054852870 9:69866578-69866600 TTACCCTCACCAGTGTAGGTAGG - Intronic
1054868141 9:70024230-70024252 TTGCCCTCCCCAATGTGGGTGGG - Intergenic
1055188118 9:73481381-73481403 TGGCCTTTACTAGTGGAGGTGGG - Intergenic
1055360365 9:75483296-75483318 TTGCCCTCCCCAGTGTGGGTGGG - Intergenic
1055405054 9:75965579-75965601 TTGCCATCCCCAATGTGGGTGGG - Intronic
1055663467 9:78530662-78530684 TGGCCTTCCCTTGTGTGTGTGGG - Intergenic
1055867325 9:80830745-80830767 TTGCCTTCCCTAATGTGGGTGGG - Intergenic
1056397793 9:86197296-86197318 TTGCCTTCTCTAATGTGGGTGGG + Intergenic
1056616948 9:88176890-88176912 TGGCCCTCCCCGATGTGGGTGGG - Intergenic
1056766108 9:89445783-89445805 TGGCCCTCCCCAGAGTGAGTTGG - Intronic
1056768501 9:89460035-89460057 TGGCCTTATCCTGGGTGGGTGGG - Intronic
1056779823 9:89541047-89541069 TGGCCCTCCCCAGTGTGGGTGGG - Intergenic
1056912915 9:90719516-90719538 TGGCCCTCCCCAGTGTGAATGGG + Intergenic
1057073550 9:92121381-92121403 TTGCCTTCACTAATGTGGGTGGG - Intergenic
1057287575 9:93772345-93772367 TTGCCTTCCCTAGTGTGGCTGGG + Intergenic
1057336582 9:94160371-94160393 TGGCCCTCCCCAGTGTGGGTGGG - Intergenic
1057473293 9:95377078-95377100 TCGCCCTCACCAATGTGGGCAGG + Intergenic
1057977657 9:99623116-99623138 TTGCCCTCCCCAATGTGGGTGGG + Intergenic
1058959029 9:109975425-109975447 TGGCCTTCACCAGTGTGGGTGGG - Intronic
1059356856 9:113706546-113706568 TGGCCCTCCCCAATGTGAGTAGG + Intergenic
1059442167 9:114314527-114314549 TGGCCCTCCCCAATGTGGCTGGG - Intergenic
1060307765 9:122431793-122431815 CCACCTTCACCAATGTGGGTGGG + Intergenic
1061412842 9:130430536-130430558 TGGCCCTGAGCAGTGTGGGCCGG + Exonic
1062169338 9:135126259-135126281 TTGCCTTCACCAGTGTTGTTGGG + Intergenic
1062218077 9:135399840-135399862 TGGCCTGCACCACTGTGGGCTGG + Intergenic
1062423040 9:136493189-136493211 CCGCCCTCCCCAGTGTGGGTGGG - Intergenic
1062465253 9:136677980-136678002 TGACCTTCCCCAGGGTGTGTGGG - Intronic
1185932527 X:4219012-4219034 TGGCCTTCATCAGTGTGTACTGG + Intergenic
1186068537 X:5792376-5792398 TGGCCTTTTCCAATGTGGGTGGG + Intergenic
1186723038 X:12326474-12326496 TGGCCATCACAACTGGGGGTGGG - Intronic
1188989519 X:36800808-36800830 TTTCCTTCGCCAATGTGGGTGGG + Intergenic
1189073819 X:37894729-37894751 TTGCTCTCACCAATGTGGGTGGG + Intronic
1189539120 X:41967741-41967763 TGGCCCTCCCCAGTGTGGGTAGG - Intergenic
1189666057 X:43355986-43356008 TTGCCATCACCAATGTGGGTAGG - Intergenic
1189693164 X:43637669-43637691 TGGCCTCCACCAGTCTAGCTTGG + Intergenic
1190634940 X:52424412-52424434 TTGCCTTACCCAATGTGGGTGGG + Intergenic
1190639036 X:52465253-52465275 TTGCCCTCTCCAGTGTGGGTGGG + Intergenic
1190969010 X:55330936-55330958 TGGCCCTCACCAATGTGGATGGG + Intergenic
1192895893 X:75442186-75442208 TTGTCTTCCCCAGTGGGGGTGGG + Intronic
1193097218 X:77564060-77564082 TTGCCCTCATCAGTGTGAGTGGG - Intronic
1194006465 X:88499647-88499669 TGGTCTTCAGCAGTGTTGTTAGG - Intergenic
1194072053 X:89338056-89338078 CCACCTTCACCAGTGTGGGCAGG - Intergenic
1194186915 X:90781939-90781961 TTGTCCTCACCAGTGTGGGTGGG - Intergenic
1195303029 X:103550708-103550730 TTGCCCTCCCCAGTGTGGGTGGG + Intergenic
1197224064 X:123939217-123939239 TGGCCCTCCCCAGTGTGGGTGGG + Intergenic
1197656670 X:129124183-129124205 TGGACTTCACTATTTTGGGTGGG - Intergenic
1197678675 X:129358803-129358825 TGGCTGCCCCCAGTGTGGGTGGG - Intergenic
1199689078 X:150293438-150293460 TTGTCTTTGCCAGTGTGGGTGGG - Intergenic
1199868236 X:151873492-151873514 TGGCCATCCCCAATGAGGGTCGG + Intergenic
1200533505 Y:4364013-4364035 TTGTCCTCACCAGTGTGGGTGGG - Intergenic
1200726296 Y:6673807-6673829 CCACCTTCACCAGTGTGGGCAGG - Intergenic
1201526009 Y:14935333-14935355 TGACCTTCCCCAGTGTGGGTGGG - Intergenic
1201713536 Y:17018155-17018177 TGGCCTTCATCAGTATGTATCGG + Intergenic