ID: 1058959120

View in Genome Browser
Species Human (GRCh38)
Location 9:109976276-109976298
Sequence ATTGTTGTGGGGATTAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058959120_1058959125 17 Left 1058959120 9:109976276-109976298 CCTCACTTAATCCCCACAACAAT No data
Right 1058959125 9:109976316-109976338 TTATTCATGCCATTTTACAAAGG No data
1058959120_1058959126 20 Left 1058959120 9:109976276-109976298 CCTCACTTAATCCCCACAACAAT No data
Right 1058959126 9:109976319-109976341 TTCATGCCATTTTACAAAGGAGG No data
1058959120_1058959128 29 Left 1058959120 9:109976276-109976298 CCTCACTTAATCCCCACAACAAT No data
Right 1058959128 9:109976328-109976350 TTTTACAAAGGAGGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058959120 Original CRISPR ATTGTTGTGGGGATTAAGTG AGG (reversed) Intronic