ID: 1058960420 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:109988070-109988092 |
| Sequence | TAACCTAGGCCACATGTCAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 111 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 103} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1058960420_1058960422 | -7 | Left | 1058960420 | 9:109988070-109988092 | CCTTTGACATGTGGCCTAGGTTA | 0: 1 1: 0 2: 0 3: 7 4: 103 |
||
| Right | 1058960422 | 9:109988086-109988108 | TAGGTTATTATTATCTCAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1058960420 | Original CRISPR | TAACCTAGGCCACATGTCAA AGG (reversed) | Intronic | ||