ID: 1058960420

View in Genome Browser
Species Human (GRCh38)
Location 9:109988070-109988092
Sequence TAACCTAGGCCACATGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058960420_1058960422 -7 Left 1058960420 9:109988070-109988092 CCTTTGACATGTGGCCTAGGTTA No data
Right 1058960422 9:109988086-109988108 TAGGTTATTATTATCTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058960420 Original CRISPR TAACCTAGGCCACATGTCAA AGG (reversed) Intronic