ID: 1058961424

View in Genome Browser
Species Human (GRCh38)
Location 9:109995900-109995922
Sequence ATGGAGAGGAAGGATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058961416_1058961424 12 Left 1058961416 9:109995865-109995887 CCTTGGAGGCCTGAACTGGTGCA 0: 1
1: 0
2: 0
3: 11
4: 230
Right 1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG No data
1058961417_1058961424 3 Left 1058961417 9:109995874-109995896 CCTGAACTGGTGCACTTGCCATG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058961424 Original CRISPR ATGGAGAGGAAGGATGAGGC AGG Intronic
No off target data available for this crispr