ID: 1058970046

View in Genome Browser
Species Human (GRCh38)
Location 9:110072824-110072846
Sequence GTATCAACCAAGGTAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058970046_1058970051 0 Left 1058970046 9:110072824-110072846 CCCAGCTCTACCTTGGTTGATAC 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1058970051 9:110072847-110072869 CCCAAATGCCCCTTTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058970046 Original CRISPR GTATCAACCAAGGTAGAGCT GGG (reversed) Intronic
907737720 1:57131282-57131304 GGATCAACTAAGGTACAGGTAGG - Intronic
915074746 1:153298887-153298909 ATATAAAGCAAGGTGGAGCTGGG + Intronic
917028836 1:170668004-170668026 ATATCAACCAAGGTGGGGGTGGG - Intronic
919802820 1:201363845-201363867 ATATCAACCTAGGAAGTGCTGGG - Intronic
922148282 1:222971447-222971469 GTATCATACAAGGTTGAGTTTGG - Intronic
1068323216 10:55447949-55447971 GTAGCTTCCAAGGAAGAGCTAGG + Intronic
1073973979 10:109078365-109078387 GTATCAAAAAAGGTGGAGCTAGG - Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1083821007 11:65171394-65171416 GTTACCACCCAGGTAGAGCTGGG + Exonic
1084727083 11:70948982-70949004 CTATCAACCAAACGAGAGCTGGG + Intronic
1093594788 12:20947393-20947415 GTATCTAGTAAGGTAGAGGTAGG + Intergenic
1095396932 12:41772188-41772210 GTATCAAACAAGGTCCAGTTAGG - Intergenic
1097007771 12:55931508-55931530 GTCTCAAGCAGGGTAGAGCCCGG + Intronic
1113264860 13:108606444-108606466 GTAAAGACCAAGGTACAGCTTGG + Intronic
1114768602 14:25403346-25403368 GGAGCCCCCAAGGTAGAGCTAGG + Intergenic
1122872509 14:104646518-104646540 GGAGCAACCAGGGCAGAGCTTGG - Intergenic
1126044108 15:44622418-44622440 TTATCAAATAAGGTAGTGCTGGG + Intronic
1130707604 15:86247948-86247970 GAATCATCCCAGATAGAGCTGGG + Intronic
1138565313 16:57828591-57828613 GGATCCATCAGGGTAGAGCTGGG - Intronic
1141251612 16:82363928-82363950 GAATGGACCAAGGTAGAGTTGGG + Intergenic
1141320465 16:83003968-83003990 GTATTAACAAAGGAAGAGGTAGG + Intronic
1144488267 17:15685747-15685769 GTATAAATCAGTGTAGAGCTGGG - Intergenic
1144912755 17:18696561-18696583 GTATAAATCAATGTAGAGCTGGG + Intergenic
1149190113 17:54050862-54050884 GTATTTACAAAGATAGAGCTTGG - Intergenic
1158762239 18:60403557-60403579 GTACCCACCCAGGTGGAGCTTGG - Intergenic
1159219342 18:65439554-65439576 ACACCAACCAAGGTAGAGATGGG - Intergenic
1159396956 18:67871781-67871803 GAATGAACCAAGGGAGAGGTAGG - Intergenic
1161647028 19:5459467-5459489 GTGACAACGAAGGTAGAGATTGG + Intergenic
1163173395 19:15548533-15548555 GTATCAACCAAGGCAGGGCTTGG - Intronic
1164472447 19:28547421-28547443 GTTTCAGGCAAGATAGAGCTTGG + Intergenic
926902003 2:17761795-17761817 GTAACATACAAGGTAGAGATAGG - Intronic
927397453 2:22670191-22670213 GTATGACCCTGGGTAGAGCTTGG + Intergenic
928536497 2:32246479-32246501 GTGACAAGCAAGGCAGAGCTGGG + Intronic
941957196 2:171216799-171216821 GTAACAACAAAGGCAGAGATTGG + Intronic
943332707 2:186578902-186578924 GTACCAACCAAGGTGTAGCAAGG + Intergenic
948752231 2:240139446-240139468 GTATCACTGTAGGTAGAGCTGGG - Intronic
1169521911 20:6383063-6383085 TTATCAACCAAGGTAAAAATTGG + Intergenic
1169910012 20:10640343-10640365 GTTTCAGCCAAGGGAGAGATTGG - Intronic
1182588334 22:31359730-31359752 CTATCAACTGAGGTGGAGCTTGG + Intergenic
955155195 3:56409758-56409780 ATAGGAACCAAGGTATAGCTGGG - Intronic
958135511 3:89484700-89484722 GCATTAACCAAGGTAGAGCATGG - Intergenic
960606260 3:119508581-119508603 GTGTCAACCAAGGTAGCACTTGG - Intronic
961870512 3:129984386-129984408 GCATGAATGAAGGTAGAGCTGGG + Intergenic
971252061 4:24981230-24981252 GTGTCCCCCAAGGAAGAGCTTGG + Intergenic
972451459 4:39203838-39203860 TTTTAAGCCAAGGTAGAGCTAGG + Intronic
976838169 4:89399982-89400004 GTCTCAATCAAGATAGATCTGGG - Intergenic
977025905 4:91819608-91819630 GAATCAACCAAGCTAAAGGTAGG - Intergenic
984379567 4:178973686-178973708 GTATAAACCAAGGTTGATCCTGG + Intergenic
989279950 5:39629272-39629294 GTAACAACAGAGGTAGAGATTGG - Intergenic
991620587 5:68540988-68541010 GTATTAAACAAGGGAGCGCTCGG - Intergenic
991914220 5:71589947-71589969 GAACCCACCTAGGTAGAGCTGGG - Intronic
994023679 5:95057682-95057704 GTATTTACCAAGGTAAAGCTGGG - Intronic
994304536 5:98186972-98186994 GTATCAACAAAGGTTGAGAAAGG + Intergenic
1000659482 5:163920274-163920296 GAAGGAACCAAGGTATAGCTTGG + Intergenic
1004267940 6:14165570-14165592 TTAGCAACCAAGGTAGAGAGAGG + Intergenic
1004576184 6:16897474-16897496 GGATCACCCAAGCTAGAGTTCGG - Intergenic
1006179822 6:32148148-32148170 GAATCCACCAAGGAAGACCTTGG - Intergenic
1006535312 6:34695126-34695148 GCATCATCCAGGGTAGAACTAGG + Intronic
1010373268 6:75136496-75136518 GTATTAGCCAAGGTAGGGGTTGG - Intronic
1017480964 6:154854315-154854337 GTATCTACTAAGGTAGAGTGAGG - Intronic
1023220927 7:37919665-37919687 CTATCAATCAATGTAAAGCTAGG - Intronic
1024557011 7:50612530-50612552 ATATTAAACAGGGTAGAGCTAGG - Intronic
1027269804 7:76513152-76513174 CTCTCCACCAAGGTAGCGCTGGG + Intronic
1030232883 7:107226298-107226320 GCATCATCCAAGTTAGACCTTGG - Intronic
1031446506 7:121861551-121861573 GAATTACCCAAGGTAGAGCAAGG - Intergenic
1032256699 7:130302880-130302902 GTAGCACCCAAGGCAGAGATGGG + Intronic
1039009773 8:33080270-33080292 GTAACAATGAAGGTAGAGATTGG + Intergenic
1042174240 8:66023153-66023175 GTATCAAGCTAGTTAGTGCTGGG + Intronic
1043072259 8:75653281-75653303 GAAACAACAAAAGTAGAGCTGGG + Intergenic
1044106936 8:88221077-88221099 ATACCAGCCATGGTAGAGCTGGG + Intronic
1045255135 8:100513375-100513397 GTATCAACCCTGGTAGGGCCTGG + Intronic
1046505729 8:115135833-115135855 GCCTGAAGCAAGGTAGAGCTTGG + Intergenic
1047825320 8:128567350-128567372 GTGTCAACCAAGGAAAACCTCGG + Intergenic
1048115026 8:131511404-131511426 GTATCAATCCAGATAGAGGTGGG - Intergenic
1050077964 9:1884378-1884400 GTATGAGCCAACGTTGAGCTGGG + Intergenic
1058785054 9:108378779-108378801 GTCTCCAGGAAGGTAGAGCTGGG + Intergenic
1058970046 9:110072824-110072846 GTATCAACCAAGGTAGAGCTGGG - Intronic
1189301435 X:39955345-39955367 GCATCAACCCAGGAAGTGCTGGG + Intergenic
1192998815 X:76541278-76541300 GTATCTGCTAAGGTAGAGGTGGG + Intergenic
1195751366 X:108164162-108164184 GTAGCAACCAAGGTACTGCGAGG + Intronic
1196381034 X:115089839-115089861 GTAACAACCCAGGTAGAGAGGGG + Intergenic