ID: 1058970125

View in Genome Browser
Species Human (GRCh38)
Location 9:110073722-110073744
Sequence CAGAGAAAAGACTCTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 507}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058970125_1058970133 3 Left 1058970125 9:110073722-110073744 CCCTCCCCAGAGTCTTTTCTCTG 0: 1
1: 0
2: 3
3: 56
4: 507
Right 1058970133 9:110073748-110073770 AAGTTCTGAAAAATTGTTTCAGG No data
1058970125_1058970134 4 Left 1058970125 9:110073722-110073744 CCCTCCCCAGAGTCTTTTCTCTG 0: 1
1: 0
2: 3
3: 56
4: 507
Right 1058970134 9:110073749-110073771 AGTTCTGAAAAATTGTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058970125 Original CRISPR CAGAGAAAAGACTCTGGGGA GGG (reversed) Intronic
900113951 1:1020737-1020759 CCGGGAAAGGCCTCTGGGGAGGG - Intronic
900175157 1:1288270-1288292 CGGAGCAGAGACTCGGGGGACGG - Intronic
900175260 1:1288696-1288718 CGGAGCAGAGACTCGGGGGACGG - Intronic
900175286 1:1288808-1288830 CGGAGCAGAGACTCGGGGGACGG - Intronic
900175315 1:1288938-1288960 CGGAGCAGAGACTCGGGGGACGG - Intronic
900175334 1:1289030-1289052 CGGAGCAGAGACTCGGGGGACGG - Intronic
900175342 1:1289068-1289090 CGGAGCAGAGACTCGGGGGACGG - Intronic
900175490 1:1289666-1289688 CGGAGCAGAGACTCGGGGGACGG - Intronic
900175536 1:1289849-1289871 CGGAGCAGAGACTCGGGGGACGG - Intronic
900991999 1:6102385-6102407 CACAGAAGAGACTTGGGGGAGGG + Exonic
901589631 1:10329714-10329736 CAGAGCAAAGACTCTGTCTAGGG + Intronic
902182600 1:14700729-14700751 CACAGAAAAGACTCTGGCCAGGG + Intronic
902924346 1:19686058-19686080 CAGAGAAAATCAGCTGGGGAAGG + Intronic
903697151 1:25216218-25216240 AGGAGAAGAGATTCTGGGGAAGG + Intergenic
903963291 1:27070765-27070787 TGGAGAAGGGACTCTGGGGAAGG - Intergenic
904309701 1:29620902-29620924 CCGAGAGAAGCCTCTGGGCAGGG - Intergenic
904648760 1:31988308-31988330 AAAAAAAAAAACTCTGGGGAGGG + Intergenic
904703900 1:32376340-32376362 CAGAGTAGAGACTCTGAGGGAGG - Exonic
905058298 1:35117947-35117969 GAGAGAAAATAGGCTGGGGACGG + Intergenic
905284062 1:36867965-36867987 CCAGGACAAGACTCTGGGGAAGG + Intronic
906698229 1:47839196-47839218 CTGAGAATAGACTCTGTGGTGGG - Intronic
906942284 1:50265707-50265729 CAGAGATAACATTGTGGGGAGGG + Intergenic
909642826 1:77886835-77886857 CTGAGTAAATACTGTGGGGATGG + Intergenic
910339510 1:86169575-86169597 CATGGAAAAGATTCTAGGGAAGG + Intergenic
910750312 1:90621950-90621972 CTGTGAAAAGACTCTACGGAAGG + Intergenic
911051503 1:93675550-93675572 CAGAGGAAAGCCACTGGGGTGGG + Intronic
911089764 1:94009224-94009246 CAGAGTAAAGACTCAGGGCCTGG + Intronic
912154675 1:106903350-106903372 CAAAGAACAGAGGCTGGGGAAGG - Intergenic
913132296 1:115851713-115851735 ATGAGAAAAGAGTCTGGGGAGGG + Intergenic
913354002 1:117898054-117898076 CAAATAAAACACTCTGGGAATGG + Intronic
913485576 1:119329976-119329998 CAGAGAAAAGACCCGGGGCCGGG + Intergenic
914392712 1:147236713-147236735 CAGAGAGTAGACCCTGGGGTGGG + Intronic
914765580 1:150635196-150635218 CAGAGACAATACGCTGCGGAAGG + Intergenic
914857893 1:151365501-151365523 AAGAGAAGAGAAGCTGGGGATGG - Intronic
915457290 1:156049328-156049350 CAGAGCAAAGACTTGGGGGTGGG - Intronic
915598649 1:156909056-156909078 CAGAGAGAAGACTTGGGGGATGG + Intronic
915751338 1:158213386-158213408 CAGAGAGGAGACCCTGGGGTGGG - Intergenic
916010812 1:160703840-160703862 CAGAGCAAAGGCCCTGGGGCAGG + Intronic
916170613 1:161998972-161998994 CAGAGAAAAGGCCCTGAGGCAGG + Intronic
916255516 1:162783487-162783509 CACAGGAAAGACACAGGGGAAGG + Exonic
917394259 1:174575450-174575472 CAGATAAACAAATCTGGGGATGG - Intronic
918142424 1:181730778-181730800 CCTAGAAATGACTCGGGGGAGGG + Intronic
918257865 1:182766247-182766269 CAGAGAAAAGATGCTGGTGCTGG - Intergenic
919527118 1:198667186-198667208 TAGACAAAAGCTTCTGGGGAAGG - Intronic
920876433 1:209840514-209840536 CAGAGAAATGACTCTTGCTAAGG - Intronic
921114459 1:212074979-212075001 CAGAGAAAAGAGGATGGGGTGGG - Intronic
921314608 1:213878423-213878445 AAGAGAAGGGACTTTGGGGAAGG + Intergenic
921835071 1:219770143-219770165 CAGAGAAAGGACCTTGGGGAAGG - Intronic
921835389 1:219772814-219772836 AAGAGAAAGGGCTATGGGGAGGG + Intronic
923755315 1:236786071-236786093 CAGAGAGGAGACCCTGGGGTGGG - Intergenic
1062789108 10:290084-290106 CAGAGAGGAGACGCTGGGGAGGG + Intronic
1062957155 10:1547875-1547897 CAGAGCCAAGACTCAGGGCAGGG + Intronic
1062992377 10:1832593-1832615 CAGTGCAAAGACCCTGGGGCAGG + Intergenic
1064309835 10:14202316-14202338 CACAGAAAAGCCTCTTTGGAGGG + Intronic
1066101515 10:32122358-32122380 CAGAGAGGAGACTCTGGAGTGGG + Intergenic
1067574533 10:47400935-47400957 CAGAGAAAGGACTCAGATGAGGG + Intergenic
1068533146 10:58211082-58211104 GAGAGACTAGACTCTGGAGAGGG + Intronic
1069182035 10:65373896-65373918 CATGGACAAGCCTCTGGGGAAGG - Intergenic
1069624469 10:69859435-69859457 CAGAGAAGAGGGGCTGGGGAAGG - Intronic
1070721755 10:78761711-78761733 CAGGGCAGAGACTCAGGGGAAGG + Intergenic
1070869799 10:79741180-79741202 AAGAGAAATGACTCAGAGGATGG + Intergenic
1071200023 10:83211521-83211543 AAGAGAAAAGACTCAGAGGCAGG + Intergenic
1071333759 10:84585417-84585439 CACAGGGAAGACCCTGGGGAAGG + Intergenic
1071476710 10:86031865-86031887 CAGTGCAAAGACTCTGAGCAGGG - Intronic
1071636725 10:87263400-87263422 AAGAGAAAGGACTCAGAGGATGG + Intergenic
1071658524 10:87474554-87474576 AAGAGAAAGGACTCAGAGGATGG - Intergenic
1073579020 10:104646891-104646913 CTGAGAAAAGGCTCTGGATAGGG + Intronic
1073952421 10:108825568-108825590 TAGTGAAAATACTTTGGGGATGG - Intergenic
1074456639 10:113601263-113601285 CAGAGAGAAAGCTCTGGGTAGGG - Intronic
1074681778 10:115914318-115914340 AAGACAAAAGTCACTGGGGAAGG + Intronic
1075477397 10:122747936-122747958 CAGAGAAAAGACTCCGCTGATGG - Intergenic
1075664017 10:124218072-124218094 TAGAGAACAGGCTGTGGGGATGG - Intergenic
1076470492 10:130714828-130714850 CTGAGGAAGGCCTCTGGGGATGG + Intergenic
1076717068 10:132371579-132371601 TACAGGAAAGACCCTGGGGAGGG - Intronic
1078480476 11:11671418-11671440 AAGAGAAAACATTCTGGGGCTGG - Intergenic
1078761540 11:14255703-14255725 CATAGAAAGGACTCTGAGGATGG - Exonic
1079380292 11:19932116-19932138 CTGAGAAAAGAGTCTGGCCAGGG + Intronic
1079468615 11:20756992-20757014 AAGAGAACAGACTCTGGTGGTGG + Intronic
1079510712 11:21206595-21206617 CAAAGAAAAGGCAGTGGGGAGGG - Intronic
1079564206 11:21861319-21861341 CACAAAAAAGAATCTGGAGATGG - Intergenic
1079855641 11:25600169-25600191 AAGAGAAGAGATGCTGGGGAGGG + Intergenic
1080820096 11:35797450-35797472 CAGAGAATACACTGTGGGAATGG + Intronic
1080947791 11:36994555-36994577 CAAGGAAAATAGTCTGGGGAAGG + Intergenic
1081390739 11:42525944-42525966 CAGAGAAATGAATCAGGTGAGGG - Intergenic
1081625223 11:44651439-44651461 AAGAGAAAAGACACGGGGGGTGG + Intergenic
1081851980 11:46280070-46280092 GAGAGAAAGGACTCTTGGGCTGG + Intronic
1082731828 11:56807379-56807401 GAGAGCAAAGATTCTGAGGAAGG - Intergenic
1083228504 11:61300087-61300109 CAGGGCAAAGCCTTTGGGGAGGG + Exonic
1083472819 11:62895569-62895591 CAGAGAACAGAGCCTGGGGCTGG + Intergenic
1084470730 11:69357564-69357586 CAGAGCAGAGGGTCTGGGGAAGG + Intronic
1085131951 11:74047673-74047695 CATAGGAAAGACTCTGGTGTAGG + Intronic
1085740905 11:79077693-79077715 GAGAGTTCAGACTCTGGGGAGGG + Intronic
1086289280 11:85288504-85288526 GAGAGAAAAGAATTTGGGCATGG + Intronic
1086469641 11:87094514-87094536 CAGAGGAAAGACTAGGCGGAGGG - Intronic
1086959000 11:92963246-92963268 CAGAGGCTAGACTCTGGGAAGGG + Intergenic
1087088514 11:94244342-94244364 CAGAGAAGATCCTCTGGGCAAGG - Intergenic
1087600677 11:100311072-100311094 TAGATAATAGACCCTGGGGAGGG + Intronic
1087671726 11:101114793-101114815 CAAGGAAAACAGTCTGGGGATGG - Intronic
1087816754 11:102666263-102666285 GAGAGCAAAGACTCTGCGGCAGG + Intergenic
1088187764 11:107192574-107192596 CAGAGAAAAGAGGATGGGTATGG - Intergenic
1088969778 11:114762633-114762655 CAGGGAGAAGCCTCTGCGGAAGG - Intergenic
1089289456 11:117428880-117428902 CAGAGAGAAGACTGGGGGCAGGG - Intronic
1089676329 11:120092492-120092514 CAGAGCAAAGGCTCTGAGAAGGG + Intergenic
1090002781 11:122977053-122977075 CAGAGATGGGACTCTGGGGATGG + Intergenic
1090324175 11:125870576-125870598 GAGAGAATAGGCTCTTGGGACGG + Intergenic
1090519247 11:127460936-127460958 CAGATAGAATACTCTGGAGAGGG - Intergenic
1091263300 11:134251031-134251053 CAAAGATAAGAAGCTGGGGATGG + Intronic
1091675387 12:2485386-2485408 CAGAAATAACACACTGGGGATGG - Intronic
1092804807 12:12211139-12211161 CAGATAAAAGAGTCTGGGCTGGG + Intronic
1093281847 12:17204440-17204462 CAGAGAAGAGACCCTGGAGTGGG - Intergenic
1093777089 12:23088543-23088565 CAGAGTAAAGAAGCTTGGGAGGG - Intergenic
1093907778 12:24712963-24712985 CAGAGAAGAGACACCAGGGAGGG + Intergenic
1095603214 12:44037765-44037787 CAGAGAAGAGACCCTGGAGTGGG - Intronic
1096460479 12:51819277-51819299 CACAGAAAACACTCAGCGGAGGG + Intergenic
1097029906 12:56082671-56082693 CAGAGGAAAGAGACTGGGGTAGG + Intronic
1097078135 12:56410334-56410356 CAGAGACAAGGCCCTGGAGAGGG + Intergenic
1097618458 12:61911239-61911261 CAGAGTAAAGAATCAGGGAAGGG - Intronic
1098174028 12:67772475-67772497 CACAGAACAGTCTCTGGGGAAGG + Intergenic
1098465589 12:70783274-70783296 CAGAGAGGAGGCTCTGGAGAGGG + Intronic
1100927018 12:99559777-99559799 AAGAGAAAAATCTCTGTGGATGG + Intronic
1101365177 12:104064397-104064419 CAGTGGAGAGACGCTGGGGAAGG - Intergenic
1101412135 12:104478460-104478482 CATAAAAGAGACTATGGGGAAGG - Intronic
1101788573 12:107908387-107908409 CAGAGCACAGGCTCTGGGGCAGG - Intergenic
1101841091 12:108328036-108328058 CATAAACACGACTCTGGGGAGGG - Intronic
1102862386 12:116347834-116347856 CAGTGAAAAGAGACAGGGGAGGG - Intergenic
1103403833 12:120660953-120660975 CAGAGAAAGGTCTCTGGTAAAGG + Intronic
1104558828 12:129825575-129825597 CAGAGAAGAGACACTGGGCTTGG - Intronic
1104583822 12:130031036-130031058 CAGAAAAAAGAATCTGAGGAGGG - Intergenic
1104764471 12:131317533-131317555 AAGAGAAAAGGCTCAGGGAAGGG + Intergenic
1105724921 13:23154114-23154136 CAAAGAACAAACCCTGGGGATGG - Intergenic
1105874700 13:24541440-24541462 CAGGGAACAGCCTGTGGGGAGGG - Intergenic
1106375380 13:29181530-29181552 CAGAGAAATGGTTCTGGGGCAGG + Intronic
1106537437 13:30659918-30659940 CAGAGAAAAGGCCCTGGAGAGGG + Intronic
1107519582 13:41166560-41166582 TACAGAAAAGACACTGAGGAAGG - Intergenic
1108238826 13:48439767-48439789 CAGAAAATAGGCTTTGGGGAAGG + Intronic
1109029995 13:57179349-57179371 CAGAGAGGAGGCTCTGGAGAGGG + Intergenic
1109277353 13:60317471-60317493 CAAAGAAAAGAGTCTGGGAAGGG + Intergenic
1110284444 13:73733111-73733133 CAAATAAAAGACTGGGGGGAAGG - Intronic
1110709485 13:78634251-78634273 AAGAGCACAGACTCTGGGGCTGG + Intronic
1111334130 13:86799652-86799674 CAGAGAAGAGACTTTGTGCAGGG - Intergenic
1113220997 13:108102506-108102528 CAGAATATAGACCCTGGGGAAGG - Intergenic
1113251707 13:108460620-108460642 CAGAGAAAAGAGTCTGGGTGCGG - Intergenic
1113284302 13:108829627-108829649 ATGAGAAAAGACTATGAGGAGGG + Intronic
1117080937 14:52151184-52151206 AAAAAAAAAGTCTCTGGGGAAGG - Intergenic
1117338053 14:54771649-54771671 CAGAGAAAAGCCACTTGGGATGG - Intronic
1118200073 14:63663479-63663501 CAGAGAGGAGACCCTGGGGTGGG + Intergenic
1119061277 14:71477334-71477356 CAGAGAGAAAACTATGGAGATGG - Intronic
1119377659 14:74207507-74207529 GAGAAAAAAGCCTCTGGGGCCGG + Intergenic
1119618244 14:76112527-76112549 CAGAGAGAAGGCTCTGGAGAGGG - Intergenic
1120576125 14:86183243-86183265 ATGAGAAAAGACTCAGGGTAGGG - Intergenic
1120610071 14:86628701-86628723 CAAAGCAAAGACTGAGGGGATGG - Intergenic
1120884463 14:89441110-89441132 GAGAGATAAGACTTTGGGGAAGG - Intronic
1121668651 14:95691623-95691645 AAAAGACAAGACTCTGGGGATGG + Intronic
1121708589 14:96019938-96019960 CAGTCAATAGACTCTGGGGATGG + Intergenic
1122422506 14:101586556-101586578 CATAGAGAAGACCCCGGGGAGGG - Intergenic
1122482154 14:102054300-102054322 CAGAGGGAAGACTCGGGGGTGGG - Intergenic
1124186401 15:27533380-27533402 CAGAGAAAGGAGACTGGGGTTGG - Exonic
1125361921 15:38873419-38873441 CAGCTAAAAGACTCTGAGGAAGG + Intergenic
1125367712 15:38936679-38936701 CAGAAATAAGACTCTGGGACAGG - Intergenic
1125594670 15:40876934-40876956 CAGAGAAAGGATTCTGGGCCTGG - Intergenic
1125720224 15:41841782-41841804 CAGAGCAGAGAGGCTGGGGACGG - Intronic
1126598580 15:50406127-50406149 AAGAGGAAAGGCCCTGGGGAAGG + Intergenic
1128317601 15:66671073-66671095 CAGGAAAAGGACTCAGGGGAGGG - Intronic
1128897342 15:71387439-71387461 TAGGAAAAAGACTCTAGGGAAGG - Intronic
1128965304 15:72052107-72052129 CAGAGAGGAGACCCTGGGGTGGG - Intronic
1129003567 15:72353757-72353779 CAGAGTAAAGACTCAGGGAGTGG + Intronic
1129052391 15:72793310-72793332 CAGAGCAAAGACTCTTAGGAAGG - Intergenic
1129209463 15:74059211-74059233 CAGAGATAAGGCTCCTGGGAGGG + Intergenic
1130148747 15:81294922-81294944 TAGAGAAAAGACTGCAGGGAGGG - Intronic
1130547186 15:84865285-84865307 CAGAGAAAATGCTCAGGGGAAGG + Intronic
1131228317 15:90643042-90643064 CAGAGACACAGCTCTGGGGAGGG - Intronic
1132741981 16:1418764-1418786 AAGAGAAAACAATCTGGGGCCGG + Intergenic
1133912160 16:10076173-10076195 CAGAGGAAGGCCTATGGGGATGG - Intronic
1134041329 16:11070768-11070790 CAGAGCAAAGACTCTGAGGTGGG - Intronic
1134312053 16:13083858-13083880 CTGTGAAAAGAATCTGGGCAGGG + Intronic
1134674097 16:16077276-16077298 CAGAGAAAACAATCTGTAGAAGG + Intronic
1136030345 16:27498259-27498281 CTGAGAGAAAACTCAGGGGAGGG - Intronic
1136046519 16:27619492-27619514 CAGATAACAGAGTCTGGGGTAGG + Intronic
1136478824 16:30528834-30528856 CAGAGAAAAGTGTCTTGTGAAGG - Intronic
1138089699 16:54164184-54164206 CAGAAAGTAGACTCAGGGGAGGG + Intergenic
1138463789 16:57171676-57171698 AAAAGAAGAGACTTTGGGGAAGG + Intronic
1138638840 16:58366123-58366145 CAGAGTACAGGCTCAGGGGATGG + Intronic
1139625801 16:68187651-68187673 CAGAGAGGAGACCCTGGGGTGGG + Intronic
1139745551 16:69071402-69071424 CAGAAAAAGGACTCTGGACACGG - Intronic
1139868585 16:70084942-70084964 CAGTGATAAGCCTTTGGGGAAGG + Intergenic
1140386750 16:74546937-74546959 CAGTGATAAGCCTTTGGGGAAGG - Intronic
1140407101 16:74718285-74718307 CAGAGAACAGAGTGTGGAGACGG + Intronic
1142029948 16:87833481-87833503 CAGAGACATCACTCTGTGGAGGG + Intronic
1143632887 17:8148864-8148886 AACAGCAAAGACGCTGGGGAGGG + Intronic
1146132191 17:30287880-30287902 CAGAGAAAGGAGCCTGAGGATGG - Exonic
1146681848 17:34814183-34814205 CAGAGAAGAGACTATGAAGAAGG - Intergenic
1146948385 17:36889533-36889555 CATTGAAAAGACAGTGGGGATGG - Intergenic
1147034117 17:37667342-37667364 CAGAGCAAAGTCTGTGGGGAAGG + Intergenic
1147869579 17:43578032-43578054 GAGAGAACAGAGGCTGGGGAGGG + Intronic
1148603270 17:48909350-48909372 CTGGGAAAAGACTGTGTGGAGGG - Intronic
1148723460 17:49771739-49771761 CAGAGGAAAGTCTCTGGAGAGGG + Intronic
1148752295 17:49952190-49952212 CTGAGCAAAGAGTCTGTGGATGG - Intergenic
1149599729 17:57885611-57885633 CGGCGGAAAGACCCTGGGGAAGG - Exonic
1149978905 17:61293672-61293694 AAGAGAGAAGACTATGGGGCTGG + Intronic
1150154208 17:62837019-62837041 CAGAGAAAAAAATCAGTGGAAGG + Intergenic
1150305767 17:64084078-64084100 CAGAGAAAGGACCCGGGAGAGGG - Intronic
1150362316 17:64547411-64547433 CGCAGAAAAGGCTCTTGGGAAGG + Intronic
1150366595 17:64592348-64592370 TAGAGAAAAGACACTGGGATTGG - Intronic
1151661995 17:75524177-75524199 CAGAGAAGAGATTCTACGGAAGG - Intronic
1151832003 17:76558364-76558386 CAAAGAAAGGCCTCTGGGGGAGG - Intergenic
1152031664 17:77846773-77846795 AAGAGAGAAGGCCCTGGGGATGG + Intergenic
1153656841 18:7290435-7290457 CAGAGAGAAGACTCTGCTGGGGG - Intergenic
1154974107 18:21440293-21440315 CAAAGAAACGACACCGGGGATGG + Exonic
1155053916 18:22169356-22169378 GAGAGAAAAGAGGGTGGGGAGGG - Intergenic
1155267079 18:24104511-24104533 CTGAGAGAAGTCTCTGGGCAGGG - Intronic
1155288809 18:24320249-24320271 CAGAAAAAATACTGGGGGGATGG + Intronic
1155487088 18:26356648-26356670 AAGAGGAAAGAATCTGGGGCTGG - Intronic
1155777900 18:29791427-29791449 GAGAAGAAAGACACTGGGGAAGG - Intergenic
1157042862 18:44060909-44060931 CAGAGAGGAGACCCTGGGGTGGG + Intergenic
1157042871 18:44060979-44061001 CAGAGAGGAGACTCTGTGGTGGG + Intergenic
1157394730 18:47332081-47332103 GAGACAAAAGAGTCTGGGGGTGG - Intergenic
1157623053 18:49027096-49027118 CAGAGAGATGTCTCAGGGGAGGG - Intergenic
1157956101 18:52099389-52099411 CAGAGAGAAGGCTGAGGGGATGG - Intergenic
1158670526 18:59469869-59469891 GAGAGAAAAGACTCTTAAGAGGG + Intronic
1158849097 18:61476236-61476258 CAGAGTGATGACTTTGGGGATGG - Intronic
1159000893 18:62974264-62974286 CATACAAAAGACCCTGGAGAAGG - Intronic
1159628422 18:70721166-70721188 AAGAGAAAAGAGTGTTGGGAGGG - Intergenic
1159780189 18:72652080-72652102 TAGCAAAAAGACTCTGGGCACGG + Intergenic
1161331757 19:3691959-3691981 CAGGGAAAAGAGCCTGGGGTGGG - Intronic
1161642571 19:5433510-5433532 CAGAGAAAAGAGGCCGGGTACGG + Intergenic
1162841097 19:13356973-13356995 CAGAAAAAAGGATGTGGGGAAGG - Intronic
1163147063 19:15387259-15387281 CTGAGCCAAGGCTCTGGGGATGG - Intronic
1163183183 19:15618302-15618324 GAGAGAAAAGACACTGAGGTTGG - Intronic
1163223132 19:15935735-15935757 CAGATGAAAGATTCTGAGGAGGG + Intergenic
1163370619 19:16899351-16899373 CATAAAAAAGACACTGGGGCCGG - Intronic
1163414745 19:17179383-17179405 CAGAAAAAAGACCCTAGGGAGGG - Intronic
1163822536 19:19504330-19504352 GAGAGAAAAGACTGTGGCAATGG + Intronic
1163856136 19:19703707-19703729 CACTGGAAATACTCTGGGGAGGG + Intergenic
1164277704 19:23735989-23736011 CATAGAAAAGACCCAGTGGAAGG - Intergenic
1164628475 19:29745393-29745415 AAGAGCAAAGGCACTGGGGACGG + Intergenic
1164874424 19:31673289-31673311 TAAAGAAAAGACTCTTGTGATGG - Intergenic
1164990637 19:32680172-32680194 CAGAGATGAGACTCTGGGGAAGG - Intergenic
1165166132 19:33858271-33858293 CAGATAACAGACTGTGGGCAGGG + Intergenic
1165459396 19:35935714-35935736 CAGAGAAAGGAGCCTTGGGAAGG + Exonic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166780542 19:45340479-45340501 CAAGGAAAAGGCTCTGGGGCAGG + Intronic
1166824125 19:45598826-45598848 AAGAGAAAAACCTCAGGGGAAGG - Intronic
1167587265 19:50382267-50382289 CTGAGGAAAGACTCTGCGGAGGG - Intronic
1168179254 19:54649494-54649516 AAGATAAAATACTTTGGGGATGG + Intronic
1168402496 19:56093469-56093491 CCGAGAAAACACTGAGGGGAAGG - Intronic
1168413339 19:56153705-56153727 CAGAGAAAAGCCAGTGGGGTAGG + Intronic
925067983 2:943959-943981 CAGAGAGAAGGCCCTGGAGAGGG + Intergenic
925334364 2:3082675-3082697 AAGAGAAAAGATGCTGGGAAAGG + Intergenic
925413492 2:3653755-3653777 CTGAGGGAAGACTCTGGTGAGGG + Intergenic
927477253 2:23423344-23423366 AAGAGAGAAGACCCTGGGGTGGG - Intronic
927743163 2:25590611-25590633 CAGACAGGAGACTCTGGGGTGGG + Intronic
927936954 2:27081527-27081549 CAAAGAAGAGGCTCTGTGGACGG - Intronic
928094268 2:28394153-28394175 CAGAGAGAAGACGCGGGGCAGGG - Intronic
928178481 2:29051146-29051168 CAGAGAAAAACTACTGGGGAGGG - Intronic
930036083 2:47086056-47086078 CAGAGGAAAGAGTCAGGGGTGGG - Intronic
930403014 2:50914940-50914962 CAGAGGAAGGAATCTGGTGAAGG - Intronic
930506007 2:52283705-52283727 CAAAGATAATTCTCTGGGGAGGG + Intergenic
930506884 2:52293836-52293858 CAGAGAACAGACTCAGTGCAGGG - Intergenic
930957305 2:57217863-57217885 CAGAGAGGAGACCCTGGGGTTGG - Intergenic
931798785 2:65737926-65737948 CAGGCAAAAGGCTCTGGGGTGGG - Intergenic
932020528 2:68081065-68081087 TAGAGAAATCACCCTGGGGAGGG - Intronic
932180169 2:69639840-69639862 CAGAGAAGAGAGTCCAGGGAAGG + Intronic
932387982 2:71356043-71356065 TAGATAAAAGATCCTGGGGAAGG - Intronic
932679551 2:73812986-73813008 CAGAGAAAAGACTCCTGGCAAGG + Intronic
932723420 2:74157146-74157168 CAGATCACAGCCTCTGGGGAGGG + Intronic
933219233 2:79669587-79669609 CAGAGAGAAGGCCCTGGAGAGGG + Intronic
934154389 2:89182354-89182376 CAGACTGAAGACACTGGGGAAGG - Intergenic
934212842 2:89999586-89999608 CAGACTGAAGACACTGGGGAAGG + Intergenic
934689260 2:96345714-96345736 CTGACAAAAGACTCTGGGGTGGG + Intronic
934932641 2:98440700-98440722 TAGTGCCAAGACTCTGGGGATGG + Intergenic
935170313 2:100606491-100606513 CAGAGAAAGGAGGCTGGGGAGGG - Intergenic
936663487 2:114568150-114568172 AAGAAAAAAAACTATGGGGAAGG - Intronic
936735913 2:115443282-115443304 CAGAGAAAAAAGTCTGGAGAGGG - Intronic
937118582 2:119426846-119426868 AGGAGGAAAGACTCAGGGGAGGG + Intergenic
937219794 2:120336086-120336108 CACAGACAAGGCTCAGGGGAAGG + Intergenic
938392530 2:130916648-130916670 CGGAGAAAAAACTCAGGGCAAGG + Exonic
939194898 2:138959598-138959620 CAGTGGTAACACTCTGGGGAGGG - Intergenic
939203551 2:139070670-139070692 CTGAGAAAAGAGTGTGGGAAAGG - Intergenic
941043642 2:160649241-160649263 CAGAGAGGAGACTCTGGCGTGGG - Intergenic
941464782 2:165813153-165813175 AAGAGAAAAGGCAATGGGGAAGG - Intergenic
941619558 2:167761033-167761055 CTGAGAAAAGACTCTATGGTGGG + Intergenic
944546521 2:200804283-200804305 TAGAAAAATTACTCTGGGGAAGG - Intergenic
946312062 2:218887539-218887561 CAGAGAAGAGGGGCTGGGGATGG - Intronic
946590147 2:221237434-221237456 AAAAGCAAAGACTCTGGGGCAGG + Intergenic
948572180 2:238924650-238924672 CAGAGAAAACAAGCTTGGGAAGG + Intergenic
1168988477 20:2072571-2072593 TAGAGAAAAGAGGCTGGGCACGG + Intergenic
1172174933 20:32966528-32966550 CAGAGGAAGGACACGGGGGAAGG + Intergenic
1172324898 20:34026729-34026751 CAGAGAAAAGAGGATGGGAAAGG - Intronic
1172390417 20:34561481-34561503 CAGAGTAGTGACTGTGGGGATGG - Intronic
1172620672 20:36316435-36316457 CCAAGCAAAGACTGTGGGGAAGG - Intronic
1173061567 20:39666709-39666731 CAGAGAAGAAACCCTGGAGATGG - Intergenic
1173893871 20:46534723-46534745 CAGAGAAGAGGCTCTGGAGTGGG - Intergenic
1174037515 20:47677319-47677341 CAGACCCAAGTCTCTGGGGAAGG - Intronic
1174192517 20:48750299-48750321 TAGAGAACAGACTTTTGGGAGGG - Intronic
1174587937 20:51623248-51623270 AAGAGAACAAACACTGGGGAAGG + Intronic
1174631644 20:51963355-51963377 CAGTGAAAAGACTAGGGAGAAGG - Intergenic
1175070831 20:56332466-56332488 CAGAGAACAGACTGAGGGGCTGG + Intergenic
1175200368 20:57272844-57272866 CTGGGAAGGGACTCTGGGGAAGG - Intergenic
1177089891 21:16755070-16755092 CAGAGAGAAGACTGTGTGTAAGG + Intergenic
1177288462 21:19080160-19080182 ATGAGTAAAGACTTTGGGGACGG + Intergenic
1177357802 21:20031523-20031545 CAGACAGGAGACTCTGGGGTGGG + Intergenic
1177908180 21:26997587-26997609 CAGTGAAAGGAATCTGGGTAGGG + Intergenic
1178165607 21:29972363-29972385 CAGAGAAGACAGTCTGGAGAGGG + Intergenic
1178644002 21:34369609-34369631 CAAAGAGATGGCTCTGGGGAGGG + Intronic
1179613932 21:42569660-42569682 CAGAGAACAGACCCGGGAGAGGG - Intronic
1180214353 21:46315098-46315120 GAGAGAACAGACCCTGGGGCTGG - Intronic
1180611694 22:17102351-17102373 CAGAGAAGAGACTCAGGGCTTGG - Intronic
1181677133 22:24462707-24462729 CAGAAAAAAGAATCTGGGTGGGG + Intergenic
1181746929 22:24961898-24961920 CAGAGCAGAGGCTCTGGGTAAGG + Intronic
1182362570 22:29755487-29755509 AGGAGAAAAGAGGCTGGGGATGG + Intronic
1182527543 22:30930709-30930731 TAGAGAAAAGACAATGGGAATGG - Intronic
1182615841 22:31589508-31589530 CATGGAACAGACTCTGGCGATGG + Exonic
1184950811 22:47841503-47841525 CAGGAAAAAGACTCAGGGAAGGG - Intergenic
1185024790 22:48402737-48402759 CAGAGACACGACCCTGGGGTGGG + Intergenic
1185267446 22:49911880-49911902 AAGAGAAGAGACGCAGGGGATGG - Intronic
1185371295 22:50462126-50462148 CAGAGAAGAAACTGTGGGCATGG + Intronic
949541473 3:5035357-5035379 GTGAGAAATGACACTGGGGAGGG + Intergenic
949783320 3:7713938-7713960 TAAAGAAGAGACTCTGCGGATGG - Intronic
950871662 3:16234873-16234895 AAAAGAAAAGAGTCTGGGGGAGG + Intergenic
952269323 3:31816829-31816851 CAGAGAGAAGGCCCTGGAGAGGG + Intronic
952841087 3:37646014-37646036 CAGAGTAAGGACGCTGGGGCTGG - Intronic
953577962 3:44128362-44128384 CACAGAAAATACCCTTGGGAAGG + Intergenic
953992385 3:47494382-47494404 CAAAGAAAAGAGGCTGGGCATGG + Intergenic
955241465 3:57182379-57182401 CAGAGAGGAGGCCCTGGGGATGG + Intergenic
955362088 3:58284310-58284332 TATTGAAAAGATTCTGGGGAGGG - Intronic
955946841 3:64203678-64203700 CAGAAAAGAGACGATGGGGAGGG + Intronic
957635695 3:82780918-82780940 CAGAGAAAAGCTTCTTGAGAAGG + Intergenic
957957142 3:87202049-87202071 CAGGGAAAAGCCACTGAGGAGGG + Intergenic
960048584 3:113220094-113220116 TACAGAAAACACCCTGGGGAAGG + Intronic
961007869 3:123416930-123416952 CAGAGAAAAGACCCAGCGAAAGG + Intronic
961175609 3:124832612-124832634 CAGAGAACAGACTCTGTGGAAGG - Intronic
961493618 3:127274719-127274741 CAGAGAAGAGGCCCTGGAGAGGG - Intergenic
961809592 3:129514252-129514274 CAGAGGAAAGACCGTGAGGAAGG - Intronic
962400200 3:135051914-135051936 CAAAGAAAGGACACTGAGGAAGG + Intronic
964623824 3:158739934-158739956 AGGAAAAAAGACCCTGGGGAAGG + Intronic
964822660 3:160790442-160790464 AAGAGAAAATAAGCTGGGGAAGG + Intronic
964887330 3:161499547-161499569 CAGAGTATAGTCTCTGGGGAAGG + Intronic
965528548 3:169747334-169747356 CAGAGCAAAGAAGGTGGGGAGGG + Intergenic
965843547 3:172935913-172935935 AAAAGAAAATCCTCTGGGGAAGG + Intronic
966240418 3:177749557-177749579 GAGAGACCAGACTCTGGTGAAGG - Intergenic
966308249 3:178562387-178562409 CAGAGACAGGATTCTGGGAAGGG + Intronic
966737471 3:183199528-183199550 CAAAGAAGAGAATTTGGGGACGG - Intronic
966741493 3:183238700-183238722 CACAGAAAAGACTCTCGGCCGGG + Intronic
966949165 3:184800651-184800673 TAGAGGAAAGAGGCTGGGGAAGG - Intergenic
968855920 4:3121940-3121962 CAGAGAAAAGAATCAGGAGGAGG - Intronic
969439091 4:7206891-7206913 AAGACAAATGACTCTGGGGTAGG + Intronic
970565129 4:17324487-17324509 CAGCGAACAGATTCTGGGGGTGG - Intergenic
971493111 4:27235327-27235349 CAGAGAAAAGACAGTGGGGATGG - Intergenic
972148951 4:36064846-36064868 GAGAGAAAAGACATTGGGGAAGG + Intronic
972358258 4:38303136-38303158 CAGAGAAGAGGCCCTGGGGTTGG + Intergenic
973664906 4:53149222-53149244 CAGAGAAGTGATTCTAGGGATGG + Intronic
974879567 4:67737619-67737641 CTAAAAAAATACTCTGGGGAAGG - Intergenic
975961867 4:79918703-79918725 AAGAAAAAAGACACTGGGGATGG + Intronic
976022024 4:80640500-80640522 CAGGGAGAATACTCTGGGCATGG - Intronic
976072795 4:81260788-81260810 CAGACATGAGACACTGGGGAAGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977471908 4:97452805-97452827 CAGAGAGAAGACCCTGGAGTGGG - Intronic
977487294 4:97665434-97665456 CAGAGAGGAGACCCTGGGGTGGG + Intronic
977835836 4:101645612-101645634 CAGAGAAAATGCTCAGTGGAAGG + Intronic
978219701 4:106256002-106256024 CAGAGAGAAGACCCTGGGGTGGG + Intronic
979295136 4:119023439-119023461 CAGAGCAAAGCCTCTGGGTCTGG + Exonic
979666180 4:123313221-123313243 AATTGAAAAGAATCTGGGGAGGG - Intronic
979940359 4:126754517-126754539 CAGAGACAAGACTCAGGACATGG - Intergenic
980306269 4:131064966-131064988 CAGAGATGAGACACTGGGGTGGG + Intergenic
980671171 4:136008838-136008860 CAGAGACAAGACCCTGGGGTGGG - Intergenic
980744989 4:137001289-137001311 CAGAGAAGAGACCCTGGAGTGGG - Intergenic
980906740 4:138955596-138955618 CAGTGAAAATATTCTGGAGATGG - Intergenic
982088216 4:151857813-151857835 AAGAGAAAGGTCTCTGGTGATGG - Intergenic
982782680 4:159507404-159507426 CAGAGAAACTTCTCTAGGGATGG + Intergenic
983669988 4:170225844-170225866 CAGAGAAAACATTTTGGGAAAGG + Intergenic
983715459 4:170776497-170776519 CAGATAGAAGACTCTGGAGTGGG - Intergenic
984731374 4:183070880-183070902 CACAGCAAGGACTCTGAGGAAGG - Intergenic
984810464 4:183791877-183791899 AAGAGAGAAGAGACTGGGGATGG + Intergenic
985832719 5:2247057-2247079 AAGAGAAAAGAGTCAGGGAAGGG - Intergenic
986203327 5:5599552-5599574 CAGAGCAAAAATTCTGGAGATGG + Intergenic
986215044 5:5712380-5712402 CAGAGAAGAGGCCCTGGAGAAGG + Intergenic
986243220 5:5980299-5980321 CAGAGAGAAGACTTGGAGGAAGG - Intergenic
986782517 5:11079634-11079656 CAGGGAAAAGGCCCTGGAGAGGG - Intronic
987661565 5:20884887-20884909 CAAAGAAAACTCTCTGTGGATGG - Intergenic
988512591 5:31878281-31878303 AAGAAAAAAGCCCCTGGGGAAGG - Intronic
988717078 5:33838758-33838780 CAGAGAAGAGGACCTGGGGAGGG + Intronic
988952193 5:36274493-36274515 AAGAGGAAAGTCTCTGAGGAAGG + Intronic
990606212 5:57412895-57412917 AAGTGAAAAGGTTCTGGGGATGG - Intergenic
991359253 5:65802850-65802872 CAGAGAAGAGACCCTGGGGTGGG + Intronic
991943878 5:71881446-71881468 CAGTGGAAAGTCTTTGGGGAAGG - Intergenic
992422123 5:76616889-76616911 TAGATAAAAGACCCTGGTGAGGG + Exonic
992693104 5:79259258-79259280 CAGAGAGGAGACCCTGGGGTGGG + Intronic
993719116 5:91304741-91304763 CAAATAAGAAACTCTGGGGATGG - Intergenic
994289407 5:98010641-98010663 CAGAGGTATGACTATGGGGATGG - Intergenic
995927173 5:117387677-117387699 TAAAGATAAGTCTCTGGGGATGG - Intergenic
996575236 5:124971489-124971511 AAGAGCAAAGACTGAGGGGAGGG - Intergenic
997339167 5:133129213-133129235 CAGAGAAAGGACTTTCTGGAAGG - Intergenic
997662001 5:135596398-135596420 CAAGGAAAAATCTCTGGGGAAGG + Intergenic
997710702 5:136001635-136001657 CAGAGAAAAGCCACAGAGGAAGG - Intergenic
997853408 5:137352894-137352916 GAGAGAAAAGAATATGGAGACGG - Intronic
997952724 5:138254594-138254616 CAGAGGAAAGGCTCTGGGCCAGG - Intronic
998103649 5:139454929-139454951 CAGAGAAAAGAATGGGGTGAAGG + Intronic
999799360 5:155019198-155019220 CAGAGAGGAGACCCTGGAGAGGG + Intergenic
999848081 5:155507243-155507265 CAGAGCTAAGTCACTGGGGAAGG + Intergenic
999887132 5:155936415-155936437 CAGAGAGCAGACGCTGGGGTGGG + Intronic
1000157493 5:158565988-158566010 CACAGAAAAGGCTCTGCAGAGGG - Intergenic
1001096696 5:168780911-168780933 CACAGAGAAGATTCTGGGCAGGG - Intronic
1001233665 5:170011374-170011396 CAGAGCAAACACTCTGGCTAAGG - Intronic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1002200662 5:177525981-177526003 CAGATAAAAAACCCTCGGGAAGG + Intronic
1002201027 5:177528376-177528398 GAGAGGAAAGAGGCTGGGGAGGG + Intronic
1003135005 6:3428228-3428250 CTGATAAGAGACTCTGGTGAGGG - Intronic
1003590440 6:7432481-7432503 AAGAGAAGATTCTCTGGGGACGG + Intergenic
1003803948 6:9703988-9704010 CAGAGGAAGAACTCTGGGGATGG + Intronic
1004184096 6:13407118-13407140 CAAAGACAATACTCTAGGGATGG + Intronic
1004587010 6:17012443-17012465 GAGAGAAAAGACTCAGGGTACGG - Intergenic
1004958038 6:20752078-20752100 CGGAGAGAAGAGTCAGGGGAGGG - Intronic
1005021423 6:21423077-21423099 CAGAGAGAAGGCCCTGGAGAGGG + Intergenic
1005755581 6:28922989-28923011 CAGAGAAAAGAGAGTGGGGGTGG + Intronic
1006343392 6:33459986-33460008 AAGAGCAAAGGCTCTGGGAATGG - Intergenic
1006412022 6:33879311-33879333 CACAGAAAAGACTCTGGGAGTGG + Intergenic
1006845640 6:37059629-37059651 CAGAAATAAGACGCTGGTGAGGG - Intergenic
1008027538 6:46654841-46654863 AAGAGAAAACAATGTGGGGAAGG - Intronic
1008188275 6:48422621-48422643 CAGAGAGGAGACCCTGGAGAGGG + Intergenic
1010884796 6:81223129-81223151 CAGAGAAAACACTGTGGCAAAGG + Intergenic
1011345929 6:86369624-86369646 CAGAGAAAAGGCAATGGGTAGGG - Intergenic
1011779991 6:90777601-90777623 GAGAACACAGACTCTGGGGATGG + Intergenic
1011862635 6:91779294-91779316 AAGATAAAAGATTCTGGTGAAGG + Intergenic
1012491447 6:99787179-99787201 AAGATAAAAGACTCTGTGGAAGG - Intergenic
1012968571 6:105702489-105702511 CAGAGAATAGGCTCTGGAGTCGG - Intergenic
1013375588 6:109510572-109510594 CAGAGAAGAGGCCCTGGAGAGGG - Intronic
1013608829 6:111775089-111775111 CAGAGGAAAGGCTGTGGGGTGGG + Intronic
1013693091 6:112668167-112668189 CAGAGAAAAGGCCCTGGAGTGGG - Intergenic
1013693118 6:112668308-112668330 CAGAGAAGAGGCCCTGGGGTGGG - Intergenic
1014662801 6:124193973-124193995 CAGAGAGAAGACCCTGGAGCCGG + Intronic
1015186685 6:130425015-130425037 CAGAAAAAGAACTCTGGGGATGG - Intronic
1015434757 6:133172780-133172802 CAGAGAGGAGACTCTGGAGTGGG - Intergenic
1015632474 6:135245570-135245592 CAGAAAGAAGAGTGTGGGGAAGG - Intergenic
1016213982 6:141573017-141573039 CAGTGCAAAGTCTCTGGGGAAGG + Intergenic
1016389613 6:143561585-143561607 CATAGTGAAGTCTCTGGGGAGGG + Intronic
1016813503 6:148282864-148282886 CGGAGAAATGAGTTTGGGGAGGG - Intronic
1017166208 6:151410532-151410554 CTGAGAAAAAACTCTGAGAAAGG + Intronic
1018605930 6:165597862-165597884 CAGAAAAAAGACTGTGAGGCTGG + Intronic
1019176781 6:170163466-170163488 CAGGGAAAGCACTGTGGGGACGG + Intergenic
1020204185 7:6102903-6102925 CAGAGAAGAGACTGTTGAGATGG + Intergenic
1020812423 7:12863890-12863912 CACAGAGGAGACTCTGGGGTGGG + Intergenic
1021021109 7:15599767-15599789 CAGAGAGGAGACCCTGGGGTGGG + Intergenic
1021475837 7:21059598-21059620 CAAAGAAAAGACTTTTTGGAGGG + Intergenic
1021633313 7:22667227-22667249 AAGAGAAAACATTCTGGGAAGGG - Intergenic
1022387714 7:29917012-29917034 CAAAGAAATGAATCTGCGGAAGG - Exonic
1022687671 7:32611829-32611851 CAGAGAAAACACACTGAGGTTGG - Intergenic
1023789178 7:43738073-43738095 CAGAGAGAAGGCCCTGGAGATGG - Intergenic
1024619065 7:51141911-51141933 CAGAGAACACCCTCTTGGGAAGG - Intronic
1025192449 7:56906494-56906516 AAAAAAAAAGACTCTGGGGTGGG + Intergenic
1025650438 7:63462556-63462578 CAGAAAAACGTCTTTGGGGAAGG - Intergenic
1025679499 7:63670430-63670452 AAAAAAAAAGACTCTGGGGTGGG - Intergenic
1026359554 7:69591144-69591166 CAGAGATGAGGCTCTGGAGAGGG + Intergenic
1026372026 7:69709694-69709716 CAGTGAAAAGACTCAGGAGAAGG - Intronic
1027139766 7:75648772-75648794 CAGAGAGCAGACCCTGGGAATGG + Intronic
1029177045 7:98672120-98672142 CAGAGAGAAGATGGTGGGGATGG + Intergenic
1029179462 7:98689542-98689564 CAGGGAAAAGACTCATGAGACGG - Intergenic
1030678152 7:112406303-112406325 CAGAGAAAGGTGTCGGGGGAAGG + Intergenic
1031764839 7:125765030-125765052 AAGAGAAAAGACACAGAGGAGGG + Intergenic
1031836489 7:126686071-126686093 CAGAGAGGAGACCCTGGGGTGGG - Intronic
1031979806 7:128117157-128117179 CAGATTACACACTCTGGGGATGG - Intergenic
1032258797 7:130317967-130317989 CAGAGACAAGACTGTTGAGATGG - Intronic
1033304992 7:140218687-140218709 CAGAGATAGGACTCTGGGGTGGG + Intergenic
1033412209 7:141128307-141128329 AAGAGAAAAGAGACTTGGGAAGG - Intronic
1033530217 7:142255383-142255405 CAGAAAAAGGTCTGTGGGGAGGG - Intronic
1033833206 7:145277394-145277416 CAGAGAAAAGAGCCTGTGCAGGG - Intergenic
1034242992 7:149624225-149624247 CAGAGAAAAGAGCCTCGGGTGGG + Intergenic
1034481242 7:151321539-151321561 CAGAGAGGAGGCCCTGGGGAGGG - Intergenic
1035527903 8:328215-328237 CAGAGAGAAGACTCTGAAAATGG + Intergenic
1035624283 8:1059800-1059822 CAGAGACACGCCTCTTGGGAAGG + Intergenic
1036213190 8:6858947-6858969 ATGAGAAAAGACTCTGAAGATGG - Intergenic
1036899509 8:12660222-12660244 CAGAAAGAGGACTGTGGGGATGG + Intergenic
1036900573 8:12666369-12666391 CAGAAAGAGGACTGTGGGGATGG + Intergenic
1037150264 8:15627164-15627186 CAGAGAGGAGACCCTGGGGTGGG - Intronic
1037289590 8:17336651-17336673 CACAGCAAAGTCTCTGGAGAAGG + Intronic
1037476501 8:19262922-19262944 CAGTGCAAAGGCCCTGGGGAAGG - Intergenic
1037613492 8:20496001-20496023 CATAGAGAAGACTCTGGAGGGGG + Intergenic
1037731277 8:21525763-21525785 GAAAGAAAAAGCTCTGGGGAGGG + Intergenic
1037737539 8:21579614-21579636 CAGAGAAGAGACTCTGAGCTGGG - Intergenic
1038035588 8:23683254-23683276 CAGAGAGAAGCTCCTGGGGATGG + Intergenic
1038418191 8:27412981-27413003 AAAAGAAGAGACTCTGGTGAGGG - Intronic
1038505852 8:28084430-28084452 CAGAGAAAAGATGCTGTGGAAGG - Intergenic
1038780304 8:30564346-30564368 CAGAGAAAGGTCTCTGAGGAGGG - Intronic
1038823169 8:30971971-30971993 GAGAGAAAACACTGGGGGGAAGG + Intergenic
1038933809 8:32225391-32225413 CAGAGAAGAAACTCTGGTGGTGG - Intronic
1041507076 8:58611164-58611186 GAGAGAAAAGACTCTATAGAAGG + Intronic
1042093903 8:65190826-65190848 CATAGCAAAGATCCTGGGGAGGG + Intergenic
1042337012 8:67639987-67640009 CAGAGAGGAGACCCTGGGGTGGG + Intronic
1043082504 8:75784326-75784348 CAGAGGAAAGACCCTGGAGTGGG + Intergenic
1043195575 8:77287862-77287884 CAGAGAGGAGACCCTGGGGTGGG - Intergenic
1043758339 8:84031967-84031989 CAGAGAGGAGACTCTGTGGTCGG - Intergenic
1043864124 8:85356088-85356110 CATAGAAAAAACTCTTGGGCTGG - Intronic
1044287749 8:90428748-90428770 CTGATCAAAAACTCTGGGGATGG + Intergenic
1044412636 8:91901717-91901739 AAGAGAAAAGGCCCTGGAGAGGG + Intergenic
1045111263 8:98940839-98940861 AGGAGAAAAGGCTCTGGGGTGGG + Intronic
1045439535 8:102195850-102195872 GAGAGAATCAACTCTGGGGAAGG - Intergenic
1045748930 8:105458769-105458791 AAGAGCAAAGACTCTGAAGATGG - Intronic
1046025100 8:108712836-108712858 AACAGAAAAGAAACTGGGGATGG + Intronic
1046381995 8:113463530-113463552 CAGGGAAAACATTCTGGAGAAGG + Intergenic
1046620815 8:116527805-116527827 CAGAGCAACAACTCTAGGGAAGG - Intergenic
1046855453 8:119026629-119026651 CAGAGAACAGACTCTGAAAATGG + Intronic
1047519371 8:125582756-125582778 CAGAGGTAATACTCTGGAGAAGG + Intergenic
1047539837 8:125754129-125754151 CAGAGAAAAGGGTCCGAGGAGGG - Intergenic
1048670799 8:136717319-136717341 CAGAGGAAAGAGTCTGGGAATGG + Intergenic
1048881322 8:138875012-138875034 CAGTGAAGAGACTCTGATGAAGG - Intronic
1049021792 8:139962040-139962062 CAGAGAAGAGGCCCTGGAGAGGG - Intronic
1050185326 9:2966812-2966834 CAGAGAAATGACTATAGGAATGG + Intergenic
1050185434 9:2967944-2967966 CAATGAAAAAAATCTGGGGAAGG - Intergenic
1051023033 9:12568884-12568906 TGGAGAAAAGAATCTGGGGGTGG - Intergenic
1051371435 9:16362563-16362585 CAGAGCAAAGTCTCAGGGAATGG + Intergenic
1051585938 9:18726902-18726924 CTGAGAAAAGAGACTGGGGCTGG - Intronic
1053102241 9:35380766-35380788 CAAAGAACTGACTGTGGGGAGGG + Intronic
1053562481 9:39210383-39210405 CAGAAAAAAAACTGTGGGGAAGG - Intronic
1053828284 9:42048375-42048397 CAGAAAAAAAACTGTGGGGAAGG - Intronic
1054134670 9:61408656-61408678 CAGAAAAAAAACTGTGGGGAAGG + Intergenic
1054602275 9:67139079-67139101 CAGAAAAAAAACTGTGGGGAAGG + Intergenic
1055919646 9:81445796-81445818 CAGAGGAAAGAGTATGGGGGAGG - Intergenic
1055977427 9:81968710-81968732 CAGAGACAGGTCTCTGGTGAAGG - Intergenic
1056197389 9:84241328-84241350 CACAGGTAAGACTCAGGGGAAGG + Intergenic
1056665796 9:88579676-88579698 CAGTCATAAGACTCTGGGGAAGG - Intronic
1056691843 9:88814541-88814563 CAGGGAACAAACTCTGGAGATGG - Intergenic
1056807633 9:89741089-89741111 CACAGAAAAGACTGTTAGGAAGG - Intergenic
1057354964 9:94325260-94325282 CAGTGTCAGGACTCTGGGGAAGG + Exonic
1057652788 9:96932374-96932396 CAGTGTCAGGACTCTGGGGAAGG - Exonic
1058312561 9:103522876-103522898 CCCAGAAAAGACTCTAGAGAAGG + Intergenic
1058504593 9:105655350-105655372 CAGTGAAAAGGCTCTGAGGAAGG + Intergenic
1058887054 9:109329635-109329657 GAGAGAAAAGGCCCGGGGGAGGG - Intergenic
1058970125 9:110073722-110073744 CAGAGAAAAGACTCTGGGGAGGG - Intronic
1059180930 9:112211404-112211426 CAGGGGAAAGAATCTGGGGCTGG + Intergenic
1059314255 9:113410560-113410582 CAGAGAAATGGACCTGGGGAGGG - Intronic
1059650077 9:116307931-116307953 CAGAGAAAACACTCTGTGCTGGG + Intronic
1059687756 9:116653853-116653875 CAGATCAAAGGCTCTGGGGGAGG + Intronic
1059889555 9:118786215-118786237 CTGAGAAAAGAGTGTGTGGAGGG - Intergenic
1060383726 9:123203011-123203033 CTGAGAATAAACTCTGGGGAAGG - Intronic
1061544565 9:131297027-131297049 CTGAGAAAGGAGGCTGGGGAGGG - Intronic
1061876875 9:133548474-133548496 CAGAAAATAGACTCTGAGGTGGG + Intronic
1185469533 X:374159-374181 CCGAGAAGAGAGCCTGGGGACGG + Intronic
1185546447 X:949326-949348 CAGAGAAGTTGCTCTGGGGAAGG - Intergenic
1187125560 X:16451409-16451431 CAGAGAAAAGACTTGGGGAGAGG - Intergenic
1187280244 X:17853030-17853052 CGGAGAAATGACAGTGGGGAGGG + Intronic
1187739351 X:22338693-22338715 CAGAGGAAAGACTGTGGTAATGG + Intergenic
1188352723 X:29151866-29151888 CAGAGAAAAGATACTGGCCAGGG + Intronic
1189372600 X:40440945-40440967 AAGAGAAAAGAATCAGGGAAAGG - Intergenic
1189464903 X:41271142-41271164 CAGTGAAAATACTCTGGGCTGGG + Intergenic
1190324130 X:49196219-49196241 GGGAGAAAAGAGTCTGGGGAAGG - Intronic
1190620657 X:52284394-52284416 CAGAGAGAAGGCTCTGAAGAGGG + Intergenic
1190807910 X:53856456-53856478 CAGAGGAAGGACTCAGGGCAGGG - Intergenic
1191012798 X:55778245-55778267 AAGAACAAGGACTCTGGGGATGG + Intergenic
1192428960 X:71099998-71100020 CAGAGAACTGGCTCTGGGCAGGG + Intronic
1193554168 X:82932747-82932769 CAGAGAGAAGACCATGGGGTAGG - Intergenic
1193554178 X:82932817-82932839 GAGAGAGAAGACTCTGGGGTGGG - Intergenic
1193699224 X:84742452-84742474 CAGAGAACAGAATCTCAGGAGGG + Intergenic
1193773180 X:85612002-85612024 ATAAGAAAAGACACTGGGGAGGG + Intergenic
1194388910 X:93292340-93292362 CAGAGAAAAGGCACTGAAGAGGG + Intergenic
1194476125 X:94361830-94361852 CAGACCAACAACTCTGGGGATGG - Intergenic
1194797578 X:98231404-98231426 CAGAGAAATGAGTCTGTGAATGG + Intergenic
1195151128 X:102071567-102071589 CTGAGAAAATATTCTGAGGAAGG + Intergenic
1195313913 X:103659286-103659308 AAGAGAAAAGACTAGGGGAAGGG + Intergenic
1195393471 X:104387029-104387051 CAGAGAAATGTATGTGGGGAGGG + Intergenic
1195786871 X:108534565-108534587 CAGAGAACAGAGACTGGGAAGGG + Intronic
1197330360 X:125146291-125146313 TGGAAAATAGACTCTGGGGAGGG + Intergenic
1198426606 X:136527259-136527281 GACAGAAGAGAATCTGGGGATGG - Intergenic
1198521876 X:137461235-137461257 TAGAGAAAAGAGGCTGGGCATGG + Intergenic
1198928049 X:141821708-141821730 GACTGAAAAGACTCTGGGAAAGG + Intergenic
1199092348 X:143706160-143706182 CAGAGAGAAAACCCTGGAGAGGG - Intergenic
1199094227 X:143721066-143721088 CATAGGAATGACTGTGGGGAAGG - Exonic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1199500135 X:148499655-148499677 CAGAGAAAGGTCTGTGGGAAGGG - Intergenic