ID: 1058970272

View in Genome Browser
Species Human (GRCh38)
Location 9:110075202-110075224
Sequence CTACTCTTCTAAGGCTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058970268_1058970272 -9 Left 1058970268 9:110075188-110075210 CCTGTAGTTCATCCCTACTCTTC 0: 1
1: 0
2: 3
3: 29
4: 291
Right 1058970272 9:110075202-110075224 CTACTCTTCTAAGGCTTGAATGG No data
1058970267_1058970272 3 Left 1058970267 9:110075176-110075198 CCTACTCTTTTACCTGTAGTTCA 0: 1
1: 0
2: 1
3: 13
4: 212
Right 1058970272 9:110075202-110075224 CTACTCTTCTAAGGCTTGAATGG No data
1058970266_1058970272 4 Left 1058970266 9:110075175-110075197 CCCTACTCTTTTACCTGTAGTTC 0: 1
1: 0
2: 1
3: 22
4: 176
Right 1058970272 9:110075202-110075224 CTACTCTTCTAAGGCTTGAATGG No data
1058970263_1058970272 21 Left 1058970263 9:110075158-110075180 CCAGACCTGTAGTTCACCCCTAC 0: 1
1: 0
2: 1
3: 19
4: 75
Right 1058970272 9:110075202-110075224 CTACTCTTCTAAGGCTTGAATGG No data
1058970265_1058970272 5 Left 1058970265 9:110075174-110075196 CCCCTACTCTTTTACCTGTAGTT 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1058970272 9:110075202-110075224 CTACTCTTCTAAGGCTTGAATGG No data
1058970264_1058970272 16 Left 1058970264 9:110075163-110075185 CCTGTAGTTCACCCCTACTCTTT 0: 1
1: 0
2: 2
3: 7
4: 118
Right 1058970272 9:110075202-110075224 CTACTCTTCTAAGGCTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058970272 Original CRISPR CTACTCTTCTAAGGCTTGAA TGG Intronic
No off target data available for this crispr