ID: 1058973347

View in Genome Browser
Species Human (GRCh38)
Location 9:110102887-110102909
Sequence CTGCAGAGGCAGAAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 774
Summary {0: 1, 1: 0, 2: 5, 3: 76, 4: 692}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058973347 Original CRISPR CTGCAGAGGCAGAAAGAGGC TGG (reversed) Intronic
900002999 1:25264-25286 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
900022719 1:195789-195811 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
900093900 1:932630-932652 CTGCAGAGGCAGAAGGACCCAGG - Intronic
900220325 1:1505244-1505266 CAGCCGAGGCAGAGAGAGGGAGG + Intergenic
900340061 1:2184122-2184144 CTGGATAGGCAGAAATGGGCCGG + Intronic
900367146 1:2315923-2315945 CTGCCCAGGCAGAGAGAGGCAGG - Intergenic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900737010 1:4305333-4305355 CTGCAGAGGGACTTAGAGGCTGG - Intergenic
900740077 1:4325758-4325780 CTGCAGGGGCAGCCTGAGGCTGG - Intergenic
901246396 1:7735199-7735221 CTTCAGAAGAAGCAAGAGGCTGG + Intronic
901635008 1:10666456-10666478 CTGCAGAGGCTGGCCGAGGCTGG - Intronic
901756430 1:11444224-11444246 CTGCAGAGCCAGGAGGATGCTGG - Intergenic
902533344 1:17104727-17104749 TTGAAAAGGCAAAAAGAGGCCGG - Intronic
902721940 1:18309688-18309710 GGGCAGAGGCAAAAGGAGGCCGG - Intronic
903186041 1:21629568-21629590 CTGCTGAGGCCGTAAGGGGCAGG + Intronic
903442010 1:23395280-23395302 AGACAGAGTCAGAAAGAGGCTGG - Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903770518 1:25760911-25760933 CAGCTGGAGCAGAAAGAGGCTGG - Intronic
903988350 1:27246256-27246278 CTACAGAGACAGAAAGAGATGGG - Intronic
904211627 1:28889687-28889709 CTGCAGGGTGAGACAGAGGCTGG + Intronic
904357933 1:29953447-29953469 CTGCAGAAATAGAAAGAGCCTGG + Intergenic
904770223 1:32876982-32877004 AGGCAGAGGCAGCAAGATGCAGG - Intergenic
904875539 1:33651948-33651970 CTCCAGAGGTATAAACAGGCGGG - Intronic
905251383 1:36650932-36650954 AGGCAGAGGCAGAAGGAGGTTGG + Intergenic
905277981 1:36831308-36831330 CTGCAGCTGCAGAAAGCTGCTGG + Intronic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906149449 1:43579045-43579067 CTGCTGCTGCAGAAAGAAGCAGG - Intronic
906539384 1:46573404-46573426 GTGCAGGGGCAGACACAGGCAGG + Intronic
907164228 1:52396055-52396077 CCCAAGAGCCAGAAAGAGGCTGG - Exonic
907427695 1:54391252-54391274 CTGGAGGGGCAGAAAAAAGCCGG + Intronic
907841164 1:58158785-58158807 CTGCAGAGCCAGAAAGATGCAGG + Intronic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
908916196 1:69129454-69129476 GTTTAGAGGCAGACAGAGGCTGG + Intergenic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910711808 1:90189892-90189914 CTGCAGAGAGGGAAAGAGGAGGG - Intergenic
910713803 1:90208689-90208711 CTTCAGTAGAAGAAAGAGGCTGG + Intergenic
912258538 1:108085650-108085672 CACCAGTGGAAGAAAGAGGCTGG + Intergenic
912481476 1:109984994-109985016 CGCCAGAGGGGGAAAGAGGCGGG + Exonic
912681332 1:111730927-111730949 CTACACAGGGAGAAAGAAGCAGG + Intronic
912714202 1:111970800-111970822 CTGCAAAGAGAGAAAGAGGTGGG - Intronic
912778492 1:112522573-112522595 CTGCACAGGCAGCAGGAGGTTGG + Exonic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
913070577 1:115294824-115294846 CTGGAGAGCCAGGAAGAGCCAGG + Intronic
913961326 1:143339920-143339942 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
914055679 1:144165493-144165515 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
914123467 1:144800869-144800891 GTGCAGAGGCAGCAGGTGGCAGG - Intergenic
914764098 1:150622752-150622774 CTGCAAAAGCAGGAAGGGGCAGG + Exonic
915090419 1:153420247-153420269 CTGAGGATGCAGAAACAGGCAGG + Exonic
917641089 1:176983778-176983800 CTTGAGAGAGAGAAAGAGGCTGG - Intronic
918489196 1:185062128-185062150 CTTTTGAGGAAGAAAGAGGCAGG + Intronic
919804307 1:201371987-201372009 GTGGAGAGCCAGAAAGGGGCAGG - Intronic
919837270 1:201583459-201583481 CTGCAGAGGCCAACAGAGGTTGG + Intergenic
919938194 1:202268714-202268736 TTTGAGAGGAAGAAAGAGGCTGG - Intronic
920034408 1:203056558-203056580 CTGCAGAGGCAGAGGAAGGGAGG - Intronic
920074109 1:203324633-203324655 CTGAAGAGGCAAAACGATGCGGG + Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921280048 1:213557462-213557484 CTGGAGAGGGAAGAAGAGGCAGG + Intergenic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
921848077 1:219905172-219905194 CTGCAGAGGGAGGCAGAGGCAGG + Intronic
922433207 1:225576729-225576751 ATGAAGAGGCAGCAAGAGGGCGG + Intronic
922741122 1:228014755-228014777 ATGCAGGGGAAGAAGGAGGCTGG - Intronic
922793253 1:228322256-228322278 GTGCAGAGGCAGGGAGAGGCAGG + Intronic
922979957 1:229817202-229817224 CTGGAGAGGTATAATGAGGCAGG - Intergenic
923031232 1:230250434-230250456 CTAAAGAGGCAGAAAGAAGAGGG - Intronic
923487575 1:234449168-234449190 CTGAAGTGGCATAAACAGGCAGG + Intronic
924001720 1:239561049-239561071 CTGCAGAGTCACAAAGAAGGAGG - Intronic
924028883 1:239867011-239867033 CTGAAGAGTCAGACAGATGCAGG - Intronic
924818645 1:247465991-247466013 CTGCAGAGGCAGCAACACACGGG - Intergenic
1063048604 10:2420214-2420236 CACCAGAGGCTGGAAGAGGCAGG + Intergenic
1064913858 10:20434792-20434814 CAAGAGAGGCAGCAAGAGGCAGG - Intergenic
1065087187 10:22190413-22190435 CTACAGAGGGGGAAGGAGGCAGG - Intergenic
1065289475 10:24215281-24215303 CTGCAGAGGCTGGGAGGGGCAGG + Intronic
1066244956 10:33573781-33573803 CTGCAGAGGTGGAAACAGGACGG + Intergenic
1066261097 10:33730382-33730404 CTGCAGTGGCTGTTAGAGGCAGG + Intergenic
1066420223 10:35258521-35258543 TTACAGAGGCAAAAAGAAGCAGG - Intronic
1066546655 10:36507466-36507488 TTGCAGAGGAAGAATGAGGTTGG - Intergenic
1067029777 10:42872318-42872340 GTGCAGAGGCAGCAGGCGGCAGG + Intergenic
1067696918 10:48542485-48542507 AGGCAGAGGCAGCAGGAGGCAGG - Intronic
1068131269 10:52898029-52898051 CGGCAGAAGTAGACAGAGGCAGG - Intergenic
1069069023 10:63975197-63975219 CTGCAGAAGCAGTGATAGGCTGG - Intergenic
1069716695 10:70525796-70525818 CTGCAGCTGGAGACAGAGGCAGG - Intronic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1069873555 10:71547825-71547847 CTGCAGAGGCATCAAGTGGACGG + Intronic
1069897421 10:71688324-71688346 CTGCAGTGGCTGAAGGAGACAGG + Intronic
1070259037 10:74835568-74835590 CTGGAGAGACAGAAAGAGTTTGG + Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1070803243 10:79255626-79255648 ATGCAGAGACAGAGATAGGCAGG - Intronic
1071439984 10:85681642-85681664 CTGCGGTGGCAGAAAGGGGCTGG - Intronic
1072237898 10:93468980-93469002 CTGTGTAGCCAGAAAGAGGCAGG - Intronic
1073439464 10:103544082-103544104 CTGCAGAGGGGGACGGAGGCTGG + Intronic
1073545816 10:104347942-104347964 CAGGAGAGGCAGAGAAAGGCAGG - Intergenic
1074776621 10:116772034-116772056 GGGCAGAGGCAGGACGAGGCTGG + Intergenic
1075117826 10:119641840-119641862 CTCCAGAAGCTGGAAGAGGCAGG - Intergenic
1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG + Intronic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1075270628 10:121046646-121046668 CTTCATAGCCAGAAAGTGGCAGG - Intergenic
1075667719 10:124242960-124242982 CTGAGGAGGGAGAAACAGGCGGG + Intergenic
1076023690 10:127094630-127094652 CAGCAGAGGAAGAAAGATGCAGG - Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076578503 10:131490425-131490447 CTGCAGAGCCAGAAAGTAGATGG + Intergenic
1076628753 10:131839899-131839921 CAGCTGAGGCAGAGAGAGACAGG + Intergenic
1076917864 10:133433361-133433383 CAGCGGAGGCAGGTAGAGGCGGG - Intergenic
1076937862 10:133577438-133577460 CAGCGGAGGCAGGTAGAGGCGGG - Intergenic
1077034713 11:489052-489074 CTGCAGAGCCAGGCAGAGCCGGG - Intronic
1077093778 11:790894-790916 ATGCAGAGGCTGAAAAAGGAGGG + Exonic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077186315 11:1236902-1236924 CTGCAGAGGCAGCGAGAGAGTGG - Intronic
1077305238 11:1865974-1865996 TTACAGAGGAAGAAACAGGCTGG - Intronic
1077406925 11:2386849-2386871 CTGCAGGGCCTGAAAGAGCCTGG - Intronic
1077520352 11:3029687-3029709 GTGCAGAGGCAAAAAGAGGTGGG + Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078640540 11:13091596-13091618 CTGAAGAGGCAGGAATAGGCAGG - Intergenic
1078731919 11:13982824-13982846 CTGCAGAGAGAGAAAAAAGCAGG - Intronic
1079109774 11:17598808-17598830 CTGCAGATGGAGGGAGAGGCAGG + Intronic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1079184259 11:18221780-18221802 CTGCAGAGCCAGAGAGAGCCAGG - Intronic
1079450773 11:20598269-20598291 CTGCAGTGGCAGATTGCGGCGGG - Intergenic
1080461516 11:32458883-32458905 CTGCAGAGCCATAATGAGCCTGG - Intergenic
1080710617 11:34744022-34744044 CTAGAGAGGCTGAGAGAGGCAGG - Intergenic
1082025847 11:47571426-47571448 CAGCAGAGAAAGAAAGAAGCAGG - Intronic
1082776735 11:57251052-57251074 CAGCAGAGGCTGAAAGAAGGTGG + Intergenic
1083225167 11:61280571-61280593 GTGCAGAGAAAGGAAGAGGCAGG + Intronic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083730194 11:64648657-64648679 CTGCAGAGGCAGACCGGGGCAGG - Intronic
1083756937 11:64796894-64796916 CTGCAGAGGAGGCAAGAGGCTGG + Intronic
1083920168 11:65778180-65778202 CGGGAAAGGCAGAAAGAGGTCGG + Exonic
1084001959 11:66300703-66300725 CTGCACAGCCAGGAAGAGGAGGG + Intergenic
1084175005 11:67418473-67418495 CAGCACAGGCAGAAAGGTGCTGG - Exonic
1084370079 11:68735439-68735461 CTACAGAGTCAGGAGGAGGCCGG + Intronic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1085409255 11:76281803-76281825 CTCCAGAGTCACAAGGAGGCAGG - Intergenic
1085524515 11:77156637-77156659 CTGCAGAGGGAGGGAGTGGCAGG - Intronic
1086177640 11:83911199-83911221 GGGCAGAGGCAGAGAGAGGAAGG + Intronic
1086846927 11:91761868-91761890 CAGCACAGGAAAAAAGAGGCAGG + Intergenic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1088373589 11:109117343-109117365 CTGCAGTGGCAAAATGAGGGTGG + Intergenic
1088534542 11:110846220-110846242 CTGCAGAGGCTCAAACAGCCTGG - Intergenic
1089200037 11:116719051-116719073 CTGGAGAGGCAGATAAAGGGAGG - Intergenic
1089492529 11:118892805-118892827 GCCCAGAGGCAGAGAGAGGCAGG - Intronic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090071588 11:123549020-123549042 CTGAAGAGGCAGGAAGATGCTGG + Intronic
1090350188 11:126103022-126103044 CAGCAGAGACCGAGAGAGGCAGG + Intergenic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090737754 11:129625806-129625828 CTGCTGAGGCAGAAGCAGGAGGG - Intergenic
1090742919 11:129682347-129682369 CACCAGAAGCAGGAAGAGGCAGG - Intergenic
1091025240 11:132135798-132135820 CTGCACAGGGAGAGAGAGACAGG + Intronic
1091188756 11:133671531-133671553 CTGCAGTGCCATCAAGAGGCAGG - Intergenic
1091283687 11:134396503-134396525 TAGCAGAGGCAGAAAGAGGCTGG - Intronic
1091339447 11:134799076-134799098 CTGCAGGAGAGGAAAGAGGCAGG - Intergenic
1091376417 12:27327-27349 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091629934 12:2152420-2152442 CTGCAGAGGGAGAAAGGGAAAGG - Intronic
1091697932 12:2640579-2640601 CTGCAGCTGAAGAAAGAGACTGG + Intronic
1091797143 12:3303938-3303960 CTGCAGGGGGAGGCAGAGGCTGG + Intergenic
1092527593 12:9318623-9318645 CTGCAGAGAAAAACAGAGGCTGG + Intergenic
1092539666 12:9413132-9413154 CTGAAGAGGGAAACAGAGGCTGG - Intergenic
1092727425 12:11499544-11499566 CTGCAGAGGAAAACAGAGGCTGG - Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1092763898 12:11835462-11835484 CTGCATGGGCAGAATGAGGGAGG - Intronic
1093469799 12:19488472-19488494 TTTCAGAGGCAGAAAGAATCCGG + Intronic
1094401594 12:30067141-30067163 CTGCAGAGACAGCAAGCTGCTGG + Intergenic
1094438218 12:30445288-30445310 GTGAAGAGGCAGCAAGAGGGTGG + Intergenic
1094524634 12:31223367-31223389 CTGAAGAGGGAAATAGAGGCTGG + Intergenic
1096055528 12:48648177-48648199 CTGAAGAGGCACAATGAGGGTGG + Intergenic
1096331235 12:50714834-50714856 CTTCAGAGGCTGACAGAGGATGG + Intronic
1096634919 12:52952096-52952118 CTGCAGGGGCACAGAGAGGAGGG - Intronic
1097146455 12:56942647-56942669 GAGCAGTGGCAGGAAGAGGCAGG - Intergenic
1097147354 12:56950952-56950974 GAGCAGTGGCAGGAAGAGGCAGG - Intergenic
1097555310 12:61128929-61128951 CTTCAGAGACAGAAAGTGTCTGG + Intergenic
1098935347 12:76472655-76472677 CAGCTGAGGCAGAGAGAGACAGG + Intronic
1099653905 12:85465006-85465028 CTTAAGAGGCAAAAAAAGGCCGG + Intergenic
1099972280 12:89512646-89512668 CTCCAGAGGCTGAGGGAGGCGGG + Intronic
1101456091 12:104832278-104832300 CTACATAGGAAGAAAGAGCCAGG - Intronic
1101604469 12:106237552-106237574 TTGAATAGGCATAAAGAGGCTGG - Intergenic
1101646962 12:106640254-106640276 TGGCAGAGGCAGGAAGTGGCTGG + Intronic
1101845736 12:108361707-108361729 CTACAGAGCCAGGAAGAGGTGGG + Intergenic
1101902461 12:108800685-108800707 CTGCAGATGCAGAAGTCGGCTGG - Intronic
1103506465 12:121444684-121444706 CTGCAGAGGCTGGCAGAGACGGG + Intronic
1103933851 12:124465041-124465063 CTGCAGTGGCAGCCTGAGGCAGG - Intronic
1104031058 12:125065900-125065922 CTGCAGAGTCAGGAAGTGCCAGG - Intronic
1104400658 12:128473311-128473333 CTGAAGATGAAGATAGAGGCTGG - Intronic
1104400673 12:128473455-128473477 GTGCAGATGAAGACAGAGGCTGG - Intronic
1104465568 12:128987581-128987603 CTGCAGAGGCCAAAAGAGGAAGG - Intergenic
1104594773 12:130113597-130113619 CTGCTGGGGAGGAAAGAGGCAGG + Intergenic
1104768763 12:131346833-131346855 CTGGAGGTGCAGAACGAGGCTGG + Intergenic
1104775615 12:131388541-131388563 CTTCAGAGGCAGGAACAGCCTGG - Intergenic
1105323578 13:19349851-19349873 CGGCAGAGGCAGAAAGAAGTGGG - Intergenic
1105572825 13:21620230-21620252 CTGCAGAGCTGGCAAGAGGCAGG - Intergenic
1105870373 13:24499649-24499671 CGGCAGAGGCAGAAAGAAGTGGG + Intronic
1105923349 13:24984982-24985004 CTCCAGAGACAGAAAGGGCCTGG + Intergenic
1106273123 13:28173799-28173821 CTGCAGAGGTAGCAATAGGATGG - Intronic
1106456803 13:29934981-29935003 CTGCAGGCTCAGAAAGAGGCAGG + Intergenic
1106703999 13:32261105-32261127 TTGCTGTGGCAGAAATAGGCTGG + Intronic
1108072445 13:46642044-46642066 CTGCAGAGCCAGACCTAGGCTGG + Intronic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108952391 13:56111537-56111559 TAGCAGAGGCTGAAAGAGGTAGG - Intergenic
1109008451 13:56909370-56909392 ATTCATAGGCAGATAGAGGCGGG + Intergenic
1109321172 13:60811672-60811694 TTGCAGAGAAAGAAAGAGTCAGG - Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1109784496 13:67156284-67156306 CAGCAGAAGAAGATAGAGGCAGG + Intronic
1110568273 13:76977914-76977936 ATGCAGATGCAGATACAGGCTGG + Intergenic
1111424029 13:88056086-88056108 CTCCAGAAGCTGGAAGAGGCAGG - Intergenic
1111969051 13:94891590-94891612 GTGGAAAGGCAGAAAGAGCCTGG - Intergenic
1111971840 13:94925010-94925032 TTGCAGAGGAAAAAAGAGGGGGG - Intergenic
1112029971 13:95447963-95447985 AAGCAGAGGCAGAAAGAGCCTGG - Intronic
1112740997 13:102472512-102472534 CTGCAGACCCAGGAAAAGGCAGG - Intergenic
1113085414 13:106565203-106565225 CTGGAGAGGTAAATAGAGGCTGG - Intronic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113220228 13:108092465-108092487 CCGCAGTGGCAGAAAGAGCAAGG - Intergenic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113692789 13:112323635-112323657 CTGCAGGGGCAGGAAGCGGAGGG - Intergenic
1113839651 13:113351532-113351554 GTGCTGAGGAAGGAAGAGGCCGG - Intronic
1114368584 14:22058686-22058708 CTGCAGAGAGAGAAAGAGAGGGG - Intergenic
1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG + Intronic
1115521894 14:34241371-34241393 TTGCTGAGACAGACAGAGGCAGG - Intronic
1115692068 14:35854974-35854996 CTGCCTAGGCAGTAAGAGGGGGG - Intronic
1116399351 14:44486363-44486385 CTGCAGAGAAAGAAGCAGGCTGG - Intergenic
1117589438 14:57251338-57251360 CCACAGAGGCATAAAGAGGCTGG + Intronic
1118186561 14:63543191-63543213 CTGCAGCGGCAGCAAGAGAAGGG + Exonic
1118319982 14:64747391-64747413 CCCCAGATACAGAAAGAGGCTGG + Exonic
1119036209 14:71231946-71231968 CAGCAGAGGAAGAAAGATGATGG + Intergenic
1119079157 14:71675715-71675737 CTGCAGCTGCAGCGAGAGGCAGG + Intronic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120646599 14:87081894-87081916 CTGCACAGGGAGAAAGAGCCTGG + Intergenic
1120839962 14:89076885-89076907 CTGCAGAGGTAGGCAGGGGCTGG + Intergenic
1120910790 14:89664992-89665014 CTGTTGAGGCAGAAATTGGCAGG + Intergenic
1121021367 14:90582213-90582235 CCTCAGAGGCAGAGAGAGGGGGG - Intronic
1121317316 14:92970014-92970036 CAGCAGAGCCAGAAAAAGGCTGG + Intronic
1121392787 14:93590329-93590351 CTGCAGTGGGAGGAAGAAGCTGG + Intronic
1122074566 14:99227883-99227905 CAGCAGAGTCAAAAAGAGTCAGG + Intronic
1122830238 14:104392443-104392465 CTGGGGAGGCAGCAAGGGGCGGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123068406 14:105629407-105629429 CTGAACAGGCTGCAAGAGGCTGG - Intergenic
1123098003 14:105775432-105775454 CTGAACAGGCTGCAAGAGGCTGG - Intergenic
1123453759 15:20396294-20396316 CTGCATAGGCAGAAATATCCAGG - Intergenic
1124232264 15:27955817-27955839 CTGAAGGGGCTGAAACAGGCGGG - Intronic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124431272 15:29610831-29610853 CTGCAGAGGGATAAAGAAGGAGG - Intergenic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1125609525 15:40961071-40961093 CTCCACAGGCAGCAAGAGGAAGG - Intergenic
1126007447 15:44271729-44271751 CAGAAGTGTCAGAAAGAGGCTGG + Intergenic
1126470678 15:49007146-49007168 CTCCAGAGGAAGGAACAGGCAGG - Intronic
1126896174 15:53259064-53259086 CTGAAGAGGCAGGAAGAAGAAGG + Intergenic
1127381956 15:58438229-58438251 GGAGAGAGGCAGAAAGAGGCTGG + Intronic
1127568528 15:60216883-60216905 CATTAGAGGCAGGAAGAGGCAGG - Intergenic
1127618574 15:60711069-60711091 CTGCAGGGGCAGAGCAAGGCTGG - Intronic
1127931555 15:63600502-63600524 GTGCAGGGGCAGAAAGAGGAGGG + Intronic
1128276021 15:66354631-66354653 CTGGTGAGGTAGTAAGAGGCTGG - Intronic
1128419481 15:67478086-67478108 CAGAAAAGGCAGACAGAGGCTGG + Intronic
1128523439 15:68390626-68390648 CCACAGAGGCAGGAAGAGCCTGG + Intronic
1128621138 15:69151011-69151033 CTGGAGGGGGAGAAATAGGCTGG - Intergenic
1128645419 15:69375233-69375255 GTGCAGAGGCAGCAAGAGAGTGG - Intronic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129312400 15:74721843-74721865 TTGCAGAGGCAGAGAGAAGCTGG - Intronic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129479280 15:75810293-75810315 CAGCAGGGGAAGAAAGTGGCTGG - Intergenic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1130142110 15:81236305-81236327 CTTCTGCGGCAGGAAGAGGCAGG - Intronic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131175282 15:90205396-90205418 CTGCAGAGCCAAAGAGATGCTGG - Intronic
1131837264 15:96403260-96403282 CTGCAGGGGCTGAAAGCTGCTGG + Intergenic
1132450507 15:101965675-101965697 TTGCAGAGGAAAAAAGAGGCTGG - Intergenic
1132599065 16:765867-765889 CTGCAGAGCCAGGGAGGGGCAGG - Intronic
1132746598 16:1438810-1438832 CTGCAGGGGCAGCATGAGGTGGG - Exonic
1132805328 16:1772647-1772669 CTGCAAAGCCAGAAGGAAGCGGG + Intronic
1132829127 16:1918876-1918898 CTGCCAAGGGAGAAAGAGGCCGG + Intergenic
1133771137 16:8867803-8867825 GAACAGAGGCAGAGAGAGGCTGG + Intronic
1133924577 16:10182568-10182590 CTGAAGAGGGAGGAAGCGGCAGG - Intronic
1133931465 16:10235756-10235778 CAGCAGAGTAAGAAAGAGTCTGG - Intergenic
1134300086 16:12983140-12983162 CTGCTGAGGCAGGAAAAGCCAGG + Intronic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1134904850 16:17971580-17971602 AAGAAGAGGAAGAAAGAGGCAGG + Intergenic
1135180724 16:20271973-20271995 CTGCAGAGACATAATGAGTCAGG - Intergenic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1135518179 16:23152533-23152555 CAGCACAGGCAGACAGAGACGGG + Intergenic
1135551230 16:23399702-23399724 ACACAGAGGCAGACAGAGGCTGG + Intronic
1135999938 16:27284757-27284779 TGGCAGGGGAAGAAAGAGGCTGG + Intronic
1136479591 16:30533286-30533308 CTGCAGAGCCAGACAGAGCCTGG + Intronic
1136483370 16:30556245-30556267 CTGCAGAGCCAGACAGAGCCGGG + Intronic
1137084422 16:36102178-36102200 CGGCGGAGGCAAAAAGCGGCTGG + Intergenic
1137765617 16:50975503-50975525 CAGCAGAGGAAGAGAGTGGCTGG + Intergenic
1138436208 16:57001411-57001433 CTCAAGAGGCAGAAACAGGATGG + Intronic
1138550660 16:57746371-57746393 CTGCAGAGACAGAGAGAGAGAGG - Intronic
1139366612 16:66437572-66437594 CTGCGGAGACACAAACAGGCAGG - Intronic
1139477544 16:67210189-67210211 CTGCAGCGGCTGACAGATGCAGG - Exonic
1139884276 16:70197577-70197599 CTGCCAAGGCAGACAGAGCCTGG + Intergenic
1140368240 16:74397919-74397941 CTGCCAAGGCAGACAGAGCCTGG - Intergenic
1140887137 16:79254250-79254272 ATGTAGAGAGAGAAAGAGGCAGG - Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141459345 16:84168245-84168267 CGTCAGAGTCAGAATGAGGCTGG - Intronic
1141461150 16:84179524-84179546 CTGCGGAGGGAGGAAGAGGAAGG - Exonic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1143238971 17:5427772-5427794 GGGCAGAGGCAGAGGGAGGCTGG + Intronic
1143925046 17:10362175-10362197 CTACAGAGGCAAAAAGCGCCAGG - Exonic
1143930519 17:10418702-10418724 CTACAGAGGCAAAAAGCGCCAGG - Exonic
1144107322 17:11997581-11997603 CTGCAACGCCAGAGAGAGGCGGG - Intergenic
1144453742 17:15402510-15402532 CAGAGGAGGCAGCAAGAGGCCGG + Intergenic
1144465540 17:15493810-15493832 CTGCAGAGGGAGAGAGAGAGAGG - Intronic
1144738049 17:17565858-17565880 GAGCAGTGGCTGAAAGAGGCAGG + Intronic
1145209531 17:21003074-21003096 CTGTGGAGGCAGAGAGAGGGAGG + Intronic
1146837902 17:36126988-36127010 CTGCAGGGGCAGTAACAGGTGGG - Intergenic
1147428393 17:40357023-40357045 AGGCAGAGGGAGAAAGGGGCTGG - Intronic
1147671874 17:42181060-42181082 CGGCAGCGGCAGTAAGAGGGAGG - Exonic
1147789009 17:43001327-43001349 CTAAAGGGGCAGAGAGAGGCCGG + Intronic
1147949258 17:44097878-44097900 CTGCAGTGGCAGTGACAGGCTGG - Intronic
1148166095 17:45485023-45485045 CTGCAGACCCAGTAACAGGCCGG + Intronic
1148582760 17:48754932-48754954 CAGCAGAGGCTGGAAGAAGCAGG - Intergenic
1148644347 17:49210697-49210719 CTGGGGAGCCAGACAGAGGCTGG + Exonic
1148695322 17:49555203-49555225 CTGCATAGGGCAAAAGAGGCAGG + Intergenic
1148786544 17:50148791-50148813 CTCCAGAGGCTGCCAGAGGCTGG - Intronic
1149310254 17:55386328-55386350 CTGGAGAGGGAGGAAGAGGCGGG - Intergenic
1150137328 17:62703192-62703214 CCACAGAGTCACAAAGAGGCTGG + Intronic
1150397318 17:64831747-64831769 CTGCAGACCCAGTAACAGGCCGG + Intergenic
1150776502 17:68085876-68085898 CTGCAGAGGCAATAAAAGGGAGG - Intergenic
1151309941 17:73286758-73286780 CTGCGGATGAAGAAACAGGCAGG - Intronic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1151638652 17:75372261-75372283 GTGCAGAGGCAGATAGATACTGG - Intronic
1151732072 17:75917593-75917615 ATGTAGAGGCAGGAAGCGGCAGG + Intronic
1152302686 17:79504547-79504569 CCCCAGAGGCTGGAAGAGGCAGG - Intronic
1152318360 17:79594050-79594072 CTGATGAGTCAGACAGAGGCAGG - Intergenic
1152930474 17:83107180-83107202 CACCAGAAGCTGAAAGAGGCAGG + Intergenic
1153650796 18:7238084-7238106 CTCCAGTGGCAGAGAGAGCCAGG - Intergenic
1153999247 18:10469805-10469827 ATGCAGAGTGAGCAAGAGGCTGG + Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155678743 18:28463411-28463433 CTGTACAGGCAGCAAGATGCTGG + Intergenic
1156048042 18:32898826-32898848 CTGTACAGGAAGAAAGAAGCTGG - Intergenic
1156071259 18:33213212-33213234 CTGCTGAATCAGAAAAAGGCAGG - Intronic
1156332703 18:36139466-36139488 CTACAGAGGGCGAGAGAGGCTGG - Exonic
1156482479 18:37444987-37445009 CTTCAGGTGCAGACAGAGGCTGG + Intronic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157191471 18:45585769-45585791 ATGCAGAGGGAGAAGGGGGCAGG - Intronic
1157609765 18:48949172-48949194 GTGCAGAGGAACAAACAGGCAGG - Intronic
1159002693 18:62987880-62987902 CAGAAGTGTCAGAAAGAGGCAGG - Intergenic
1159067695 18:63588338-63588360 GTGGAGAGGCAGAGACAGGCAGG + Intronic
1160117911 18:76099330-76099352 CGGTAGAGGCAGCAAGAGTCAGG - Intergenic
1160121117 18:76131177-76131199 CTGGAGAGGCAGGCAGGGGCCGG - Intergenic
1160597017 18:79982758-79982780 TAGGAGAGGCTGAAAGAGGCAGG + Intronic
1160634750 19:66872-66894 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
1160855332 19:1214740-1214762 CTGCACAGGCAGCAGGAGGTGGG + Intronic
1160907933 19:1460530-1460552 CTGCAGAGGCAGCAACAGGGTGG - Intronic
1160936146 19:1596077-1596099 CAGCAGATACAGAAATAGGCAGG + Intergenic
1161241268 19:3225099-3225121 CGGCAGAGGCAGGCAGAGGAGGG - Intronic
1161884475 19:6983211-6983233 CACCAGAGGCTGGAAGAGGCAGG - Intergenic
1161961877 19:7527772-7527794 CTGCAGAGTCAGCACGTGGCAGG + Intronic
1161979384 19:7622662-7622684 CTGCAGGGGCAGACAGTGGCCGG + Intronic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1163549956 19:17960761-17960783 CACCAGAGGCTGGAAGAGGCAGG - Intronic
1164763233 19:30743827-30743849 CTGCAGAGGCAGCTAGGGGCTGG + Intergenic
1164914295 19:32038061-32038083 CAGCAGAGACAGAACGGGGCAGG + Intergenic
1164934862 19:32202397-32202419 CTGCAGAGCCTGCATGAGGCAGG - Intergenic
1164955174 19:32376894-32376916 CAGCAGAGGCAGAGAGAGAGAGG + Intronic
1165012585 19:32859622-32859644 AAGCAGAGGCAGAAAGTGCCAGG - Intronic
1165472803 19:36013305-36013327 GTGCAGAGGGTGAAGGAGGCAGG - Intronic
1166168527 19:41009721-41009743 TCACAGAGGCAGAAAGAGACGGG + Intronic
1166449329 19:42884674-42884696 CAGCTGAGGCAGAGAGAGGGAGG + Intronic
1166730841 19:45058168-45058190 GGGCAAAGGCAGAGAGAGGCCGG - Intronic
1166863134 19:45821133-45821155 CATCAGAGGCAGAAAAAGGTGGG + Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167567718 19:50267274-50267296 CTGCAGAGCCAGAATGGAGCTGG + Intronic
1167751878 19:51385775-51385797 CTGGAGAGGTAGACTGAGGCAGG - Intronic
1167792453 19:51690396-51690418 CTTCAAAGGGAGAAAGATGCCGG - Intergenic
1168291952 19:55361435-55361457 CTGCAGAGATAGAGGGAGGCAGG + Intronic
1168689225 19:58366865-58366887 CTCCAGAGGCCGAATGGGGCAGG - Intergenic
1202695162 1_KI270712v1_random:118170-118192 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
925154043 2:1636860-1636882 CTGCAGAGGCACACACAGGCCGG - Intronic
925736539 2:6968884-6968906 CTGCAGTGGCAGTGAGAGGCTGG + Intronic
925741241 2:7007667-7007689 CATCAGAGGCAGGAACAGGCAGG - Intronic
925846894 2:8042899-8042921 CTTCAGGGGAAGAGAGAGGCTGG + Intergenic
925926662 2:8676144-8676166 CAGCGGAGGCAGGAAGAGGCCGG + Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927408268 2:22796836-22796858 CTGCAGAGGCAGATACAGAAGGG + Intergenic
927590158 2:24348650-24348672 TTGCAGGGGCAGACAGAGCCTGG + Intronic
928103468 2:28452784-28452806 CAGCAGACGCAAAAAGAGACTGG + Intergenic
928284248 2:29975181-29975203 CTCCAGAGGCAGAAGGATGATGG + Intergenic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
929898468 2:45981844-45981866 CTGCAGAGGCAGAGACCTGCAGG - Intronic
930035837 2:47084510-47084532 CTCCAGAGGGAGAAAAAAGCAGG + Intronic
930212991 2:48662568-48662590 TTGCAGCGGCAGAGAGAGACTGG + Intronic
931665527 2:64607623-64607645 CTGCAGAGGGACAAAGGGGTTGG + Intergenic
933262741 2:80148470-80148492 CTGCAGGGGCAAACTGAGGCAGG + Intronic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
934276332 2:91575219-91575241 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
934509271 2:94924226-94924248 CTGCATAGTCACAAAGAGACTGG + Intergenic
934772644 2:96917108-96917130 GTGCACACGCAGACAGAGGCTGG + Intronic
935080607 2:99789626-99789648 GGCCAGAGGCAGGAAGAGGCTGG - Intronic
935676265 2:105597224-105597246 CTGCTGGGGAAGAGAGAGGCAGG + Intergenic
935786051 2:106549907-106549929 CTCCAGAAGCTGGAAGAGGCAGG - Intergenic
935902871 2:107811274-107811296 CTGGGGAGGGAGAGAGAGGCAGG - Intergenic
936249933 2:110860468-110860490 CCGCAGCTGCAGTAAGAGGCTGG + Intronic
936428364 2:112437394-112437416 CTGCAGAAGCAGAGAAATGCGGG - Intergenic
936566729 2:113588155-113588177 TTGCAGAGGAAAGAAGAGGCTGG - Intergenic
937167733 2:119836834-119836856 GGGCCGAGGCAGAAGGAGGCTGG - Intronic
937285892 2:120750934-120750956 CTGCAGAGCAAGGTAGAGGCAGG - Intronic
938115528 2:128600790-128600812 CGGCAGAGGCAGAAAGGGGGAGG - Intergenic
939928439 2:148202059-148202081 ATGCCTAGGCAGATAGAGGCAGG - Intronic
940051709 2:149471798-149471820 CTGCAGATGGAGTAAGAAGCTGG - Exonic
941249232 2:163142127-163142149 CTACTGAGATAGAAAGAGGCTGG - Intergenic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941567149 2:167123637-167123659 GTGAAGAGGCAGCAAGAGGGAGG - Intronic
942343007 2:174969507-174969529 TGGCAGAGGAACAAAGAGGCTGG - Intronic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
943727470 2:191267083-191267105 CTGCATAGGCAGAGAGGGACAGG - Intronic
943771254 2:191720297-191720319 CTGGACAGACAGAACGAGGCAGG + Intergenic
944347483 2:198685582-198685604 TTCCAGAGGAAGAAACAGGCAGG + Intergenic
944379667 2:199093263-199093285 GGGCAGAGGCTGAAAGAGGTTGG - Intergenic
944427937 2:199603389-199603411 CTGCAGGGGCAGAAGGGAGCTGG + Intergenic
944641129 2:201727154-201727176 CACAAGAGGCAGAAAGAGCCAGG + Intronic
944819206 2:203412338-203412360 CTACAGAAGCAGAAAAAAGCAGG - Intronic
944876593 2:203968789-203968811 GAGCAGAGGCAGAGAGAGGAGGG - Intergenic
945002855 2:205370100-205370122 GTCCAGAGGGAGAAAAAGGCAGG + Intronic
945565361 2:211391476-211391498 GGGCAGAGATAGAAAGAGGCGGG + Intronic
946149709 2:217756066-217756088 ATGCAGAGGCAGAAAAATGAGGG - Exonic
946307581 2:218864996-218865018 GGGCAGGGGCAGAAGGAGGCTGG + Intronic
946362448 2:219227630-219227652 ATCCTGAGGCTGAAAGAGGCTGG - Intronic
946716784 2:222561281-222561303 CTGCAGGGGCAGATGAAGGCTGG - Intergenic
947790779 2:232867653-232867675 CTGGGGAGGCAGGACGAGGCAGG - Intronic
948007355 2:234621309-234621331 GTGCTGAGGCAGAAAGTGGGAGG - Intergenic
948606620 2:239139797-239139819 CTGCGGAGGCAGAAATACCCTGG + Intronic
948861620 2:240755315-240755337 CAGCAGAGGCAGACAGAGCGAGG + Intronic
948924818 2:241088706-241088728 CTGCAGTGGGAGGAAGAGGCAGG + Exonic
949001576 2:241617494-241617516 CTGCAGAGCCATTAAGAGCCAGG - Intronic
1168793482 20:595899-595921 CTGCAAGGGCAGAGAGAGGCAGG + Intergenic
1168805977 20:672624-672646 CTGCAGGGTCAGGATGAGGCTGG - Intronic
1169071999 20:2738532-2738554 ATGCAGCGGCAGGAAGGGGCTGG - Intronic
1169677083 20:8166413-8166435 CTGGAGAGGTAGGAAGAGGTAGG - Intronic
1169697831 20:8410935-8410957 CACCAGAGGCTGAAAGAGGCAGG + Intronic
1170037896 20:12009324-12009346 CAACAGAGGCTGGAAGAGGCAGG - Intergenic
1170204717 20:13785410-13785432 CAGTAGAGGCCGAAAGAGGCAGG - Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171404235 20:24899100-24899122 ATGCCCAGGCAGATAGAGGCAGG - Intergenic
1172068336 20:32237538-32237560 CTGGAGAGGCAGGCATAGGCAGG + Exonic
1172620049 20:36312814-36312836 CTGCGGGGGCAGACAGAGGTGGG + Intronic
1172809530 20:37637331-37637353 CTGCAGAGGCAGTGAGGGGCAGG + Intergenic
1173066067 20:39713275-39713297 ATGGCAAGGCAGAAAGAGGCAGG + Intergenic
1173162194 20:40661301-40661323 CTGCAGAGACAGGAACAGGCAGG + Intergenic
1173398420 20:42702416-42702438 CTGCAGAGGCTTTAAAAGGCTGG + Intronic
1173531164 20:43770662-43770684 ATGCAGAGTCAGAAACAGACAGG - Intergenic
1173640744 20:44600242-44600264 CTGCAGAGGCAGGCAGGGCCAGG + Intronic
1173829804 20:46074966-46074988 TTTCAGGGTCAGAAAGAGGCTGG - Intronic
1174085417 20:48004577-48004599 CTGTAGGGGCAGACAGTGGCAGG + Intergenic
1175214891 20:57386920-57386942 CTGCAAAGACAGAAAGACACTGG - Intergenic
1175252181 20:57616426-57616448 CTGCAGGTGCTGACAGAGGCTGG - Exonic
1175270540 20:57730855-57730877 CTGAAGGGTGAGAAAGAGGCAGG - Intergenic
1175553373 20:59831279-59831301 CTGGGGAGCCAGGAAGAGGCTGG - Intronic
1175682272 20:60998072-60998094 CTGCAATGGCAGAAAGAGTGTGG - Intergenic
1175707613 20:61192693-61192715 CAGCAGAGAGAGAAAGAGACAGG - Intergenic
1175795273 20:61766918-61766940 GTGCAGAGTCAGAATCAGGCAGG - Intronic
1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG + Intergenic
1176373886 21:6077817-6077839 CTGCAGAAGCAGAGAAATGCGGG + Intergenic
1177191277 21:17853941-17853963 CTGCAGGGGAATAAAGAGTCTGG - Intergenic
1178506482 21:33167100-33167122 CTCCAGAAGCTGGAAGAGGCTGG + Intronic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1179051962 21:37896020-37896042 CTGCACAGGAAGAATGATGCTGG + Intronic
1179265409 21:39798391-39798413 CGGCAGAGGGAGAAAGAGCATGG - Intronic
1179461415 21:41537980-41538002 CTGCAGAAGCAGAGACAGACGGG - Intergenic
1179521215 21:41946474-41946496 CAGGAGGGGGAGAAAGAGGCGGG - Intronic
1179727457 21:43348403-43348425 TGGCAGAGGCAGGAAGGGGCTGG - Intergenic
1179749591 21:43460426-43460448 CTGCAGAAGCAGAGAAATGCGGG - Intergenic
1179762371 21:43540861-43540883 ATGAAGAGGCAGCAAGAGGGTGG - Intronic
1179906407 21:44425432-44425454 CTGCCGCTGCACAAAGAGGCAGG + Intronic
1179908912 21:44437829-44437851 CTGCAGGGGATGGAAGAGGCTGG + Intronic
1180197897 21:46208393-46208415 CTGGAGAGGCAGAACGTGCCTGG + Intronic
1180202167 21:46230491-46230513 CTCTGGAAGCAGAAAGAGGCTGG + Intergenic
1180622796 22:17172811-17172833 CTGGAGAGGCAGGCTGAGGCGGG + Intergenic
1180694581 22:17743693-17743715 CTGCAGAGGCAGAGTGATCCCGG + Intronic
1181034793 22:20164738-20164760 CTGCTGAGACAGAAGGGGGCCGG - Intergenic
1181315212 22:21966623-21966645 CAGCAGAGGTAGAGAGTGGCAGG - Intronic
1181508613 22:23378757-23378779 CTGCAGAGGGATGAAGAGGGTGG - Intergenic
1181594151 22:23903468-23903490 CTGCGAAGGCAGCAAGGGGCCGG + Intergenic
1181630511 22:24148747-24148769 CAGCAGAGGCAGGAAGGGCCAGG + Intronic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182467467 22:30526161-30526183 CTGCAGGGGCAGTAAGAGAGGGG - Intronic
1182476211 22:30577851-30577873 CTGCAGAATCATTAAGAGGCGGG + Intronic
1182877669 22:33706385-33706407 CTGCAGAGGAGGAAACAGGAAGG + Intronic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1184015500 22:41782942-41782964 ATGCAGAGGAGGGAAGAGGCGGG - Intronic
1184341918 22:43890950-43890972 CTGCAGGGGCGGAAGGAGGGAGG - Intronic
1184370235 22:44077289-44077311 GTGAAGAGGGAGACAGAGGCTGG - Intronic
1184631081 22:45780533-45780555 CTACAGAGGGGGAAACAGGCTGG - Intronic
1184948421 22:47821163-47821185 CTGCAGAGGCAGGGAGAACCAGG + Intergenic
1184950670 22:47840529-47840551 CTGGGGAGGCAGAAAGGGGCAGG - Intergenic
1184998810 22:48229180-48229202 CACCAGAGGCTGGAAGAGGCAGG + Intergenic
1185045139 22:48524963-48524985 CTGAAGATGGAGGAAGAGGCAGG - Intronic
1185139413 22:49092086-49092108 CACCAGAGGCTGGAAGAGGCAGG + Intergenic
1185256517 22:49836343-49836365 CACCAGAAGCCGAAAGAGGCAGG + Intergenic
949574660 3:5327323-5327345 CTGTAGAGTCTGAAACAGGCAGG - Intergenic
949873442 3:8608353-8608375 ATTCAGAGGCAGACAGAGGGAGG - Intergenic
950136214 3:10582792-10582814 AGTCAGAGGGAGAAAGAGGCAGG + Intronic
950180548 3:10910072-10910094 GTGCAGGGGCAGGGAGAGGCAGG - Intronic
950773767 3:15332600-15332622 CTGCCGCGGCAGAAAGGGGGCGG - Exonic
951521212 3:23612276-23612298 CTGCCGAGGCAAAAGGGGGCGGG + Intergenic
952905955 3:38139148-38139170 CTGCAGAGGGAGAACCATGCGGG + Intronic
953393724 3:42549737-42549759 GGGCAGAGGTAGAAAGAGGCAGG + Intronic
953727060 3:45408664-45408686 CTGCAGAAGCTCAAACAGGCTGG - Intronic
953785428 3:45907433-45907455 CAGCAGATGCAGGAAGAGACAGG - Intronic
954163858 3:48740520-48740542 CTGCAGAGGGAGGAAGGGGTAGG + Intergenic
954287760 3:49630862-49630884 AGCCAGAGGCAGGAAGAGGCAGG + Intronic
954712532 3:52512258-52512280 CTGGACAGGCAGAAAGATGGGGG + Intronic
954794640 3:53155253-53155275 GGGCAGAGGCAGAAATTGGCAGG - Intergenic
955543209 3:59999989-60000011 TGGCAGAGACAGAAAGAAGCTGG - Intronic
955584454 3:60461759-60461781 TTCCAGAGGCAGTCAGAGGCAGG + Intronic
955778652 3:62461039-62461061 CTGCAGAGGAATAAAGATGTAGG - Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
957590140 3:82186143-82186165 CTGCTGAGGCAGGAAGCGGGTGG - Intergenic
958636192 3:96750319-96750341 CTGCAAAGGCAGAGTGAGGGAGG - Intergenic
959010523 3:101070492-101070514 CTGCGGAGGCATAAATAGGGAGG - Intergenic
959421622 3:106135841-106135863 CTGCAGTGGCAGTAAGCAGCGGG - Intergenic
959819553 3:110716439-110716461 CTTCAGTGGCAGGAAGAGACAGG - Intergenic
959994660 3:112667534-112667556 TTCCAGTGGGAGAAAGAGGCTGG - Intergenic
961516934 3:127443867-127443889 CTGGGGAGTCAGACAGAGGCAGG + Intergenic
961815657 3:129548874-129548896 CTCCACAGGCAGTGAGAGGCAGG - Intronic
961863233 3:129934655-129934677 CTGCAGAGCCAGAAATAACCAGG - Intergenic
962204886 3:133426215-133426237 CTGCAGAGGCAGAAACTTGGGGG - Intronic
962215432 3:133516859-133516881 GTGAAGAGGCAGCAAGAAGCTGG - Intergenic
962343935 3:134606340-134606362 CTGGCGAGGCAGGAAGAGACAGG - Intronic
962937553 3:140094703-140094725 CAGCAGTGGCAGACAAAGGCTGG + Intronic
964431391 3:156610315-156610337 CAGGAAAGGCAGAAAGAGTCTGG + Intergenic
966624964 3:182005860-182005882 CTGGAGAGGCAGCTCGAGGCAGG + Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
966706938 3:182926378-182926400 CTGCAGAGGGAAAATGAAGCAGG - Intergenic
966881393 3:184353148-184353170 CTGCATAGGCAGGAAGGGGCTGG + Intronic
967684851 3:192408040-192408062 CTGCAGCGGCCGCAAGAGGCCGG - Exonic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968176812 3:196557642-196557664 TTTCAGATGCAGAAAGGGGCAGG + Intronic
968433504 4:573315-573337 CTGCAGAGGCCACAAGAGGCAGG - Intergenic
968434561 4:577628-577650 CTGCTGCGGCGGCAAGAGGCTGG + Intergenic
968481441 4:834843-834865 CTGCAGAGCAAGCGAGAGGCAGG + Intergenic
968809816 4:2794732-2794754 CTGAAGAGGCAGACAGAGGGAGG + Intronic
968984353 4:3867091-3867113 CTGCAGAGGCTGGAAGAGGCAGG - Intergenic
969314806 4:6375435-6375457 AGGCAGAGGCAGAAAGAGAATGG - Intronic
969386883 4:6857365-6857387 CTGCAGATGGAGCATGAGGCTGG - Intronic
969527020 4:7709031-7709053 CTGCAGCTGCAGGAAAAGGCAGG - Intronic
969677858 4:8624653-8624675 CTGCAGAGGCAGTGAGAGAGTGG - Intergenic
969678813 4:8630289-8630311 CTGCAGAGGCAGTGAGAGAGTGG - Intergenic
969679769 4:8635939-8635961 CTGCAGAGGCAGTGAGAGAGTGG - Intergenic
970424385 4:15932976-15932998 CTTCAGAGGCAGAAAGGGCTTGG + Intergenic
970678569 4:18481019-18481041 AAGCAGAGGTAGAAAGAGCCAGG + Intergenic
971255357 4:25009100-25009122 GTGCAGAGGCAGGAGGATGCAGG - Intronic
971317727 4:25581317-25581339 CAGGAGAGGAAGAAAGAGTCTGG - Intergenic
972412216 4:38806685-38806707 CAGCAGGGGGAAAAAGAGGCAGG - Intronic
972613170 4:40673837-40673859 CTGCTAAAGCAGAAAGCGGCAGG - Intergenic
974091573 4:57316644-57316666 CTGAGGAGGCAGAAAGAGGGGGG + Intergenic
975244703 4:72106618-72106640 TTAGAGTGGCAGAAAGAGGCAGG - Intronic
975281691 4:72569204-72569226 CGGGAGCGGGAGAAAGAGGCAGG + Intergenic
975299221 4:72770093-72770115 CTGCTGAGACAGAAAGAGATAGG + Intergenic
975890052 4:79016943-79016965 CTCCAGGGGCAGAGAGAGGCTGG - Intergenic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977300010 4:95256881-95256903 CTGCTGAGGGAGAAAGATGTAGG + Intronic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978466622 4:109015974-109015996 CAGCAGGGACAGGAAGAGGCAGG + Intronic
982168245 4:152636048-152636070 CTCCAGAAGAAGGAAGAGGCTGG + Intronic
982249395 4:153389245-153389267 ATGCCTAGGCAGATAGAGGCGGG - Intronic
982325100 4:154121934-154121956 CCTAAGAGGCAGAAAGATGCTGG + Intergenic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
983703222 4:170624070-170624092 CTGCAGAGGGAGATAAATGCAGG - Intergenic
984458392 4:180000617-180000639 CTGCAGAGGAAGAGAGAAACTGG + Intergenic
985666415 5:1183670-1183692 GGGCAGAGGCAGGAAGGGGCAGG + Intergenic
985677749 5:1241016-1241038 GTGCAGAAGCTGGAAGAGGCGGG + Intronic
985907522 5:2852601-2852623 GAGCAGAGGCAGAAAGAGCAAGG - Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
986759645 5:10868418-10868440 CCGCAGGGACAGAAAGAGGTGGG - Intergenic
989708863 5:44372197-44372219 CACCAGAAGCTGAAAGAGGCAGG - Intronic
990363536 5:55046151-55046173 CTACAGAGGTAGGAAGAGGCAGG + Intergenic
990378233 5:55194731-55194753 CTGAAAGGACAGAAAGAGGCTGG - Intergenic
990532336 5:56686924-56686946 CTGCAAAGGCAGAAATGTGCTGG - Intergenic
990978521 5:61580241-61580263 CTGCAGCTGCAGAGAGAGGCAGG + Intergenic
991041635 5:62182421-62182443 CTTCAGAGGCATGCAGAGGCTGG - Intergenic
991173381 5:63655276-63655298 CTGCTGAGGTAGAAAGTGGTAGG - Intergenic
991485837 5:67135819-67135841 CAGCAGAGGAAGCTAGAGGCAGG + Intronic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992174126 5:74133124-74133146 TTGCAGAGGAAGAAAAAGGCAGG + Intergenic
992269858 5:75053284-75053306 CTGCAGGCGCGGAGAGAGGCCGG + Intergenic
992689858 5:79231663-79231685 GGGCAGAGGCAGAATCAGGCAGG - Intronic
994185905 5:96815010-96815032 CTGCAGAGGTAGACATGGGCTGG - Intronic
995037082 5:107546337-107546359 ATCCATAAGCAGAAAGAGGCTGG + Intronic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
996483654 5:124004290-124004312 CTCTAGAGGCAGAAAGAGCTTGG - Intergenic
997042918 5:130278460-130278482 CTGCAGAGCCAGCAGGAGCCAGG - Intergenic
997540549 5:134658157-134658179 CTCGAGAGGCTGAATGAGGCAGG + Intronic
998013620 5:138715057-138715079 CAGCAAAGGCAAAGAGAGGCTGG + Intronic
998754854 5:145366052-145366074 CTGCACAGGCAGATTGAGGTAGG - Intergenic
999255663 5:150208850-150208872 GGTCAGAGGCAGAAGGAGGCAGG + Intronic
999374210 5:151075687-151075709 CTGCAGAGACAGAAGTGGGCTGG + Intronic
999505141 5:152186676-152186698 CTGCAGAGGAAGAAGGAAGTTGG - Intergenic
999623172 5:153492212-153492234 CTGGAGAGGCTGAAAGAGATGGG - Exonic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1001486735 5:172125176-172125198 ATGCAGATGCCGAAAGAGCCAGG - Intronic
1001642139 5:173252112-173252134 CTGCAGAAGGAGAAACAAGCAGG - Intergenic
1001901750 5:175436676-175436698 CTGCAGAGGCCACCAGAGGCAGG + Intergenic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002551353 5:179995197-179995219 CTGGAGAGAGAGAGAGAGGCAGG - Intronic
1002596468 5:180327223-180327245 GTGGAGAGGCGGACAGAGGCCGG - Intronic
1002638775 5:180620716-180620738 CTGCGTGGGCAGAAAGGGGCCGG + Intronic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003378775 6:5603636-5603658 CTGCAGATGAAGCCAGAGGCTGG - Intronic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004451829 6:15754643-15754665 CAGCAGAGGCAGAAAACAGCTGG - Intergenic
1006154556 6:32007246-32007268 CTGCAGAGGGTGAAAGGAGCGGG - Intergenic
1006160867 6:32039982-32040004 CTGCAGAGGGTGAAAGGAGCGGG - Intronic
1006467181 6:34202764-34202786 CTGCAGGGACAGAAAGGGGGTGG + Intergenic
1006903276 6:37516566-37516588 CTGCAGAGGCAGGGAGGGGGAGG - Intergenic
1007074985 6:39060625-39060647 GGGCAGAGGGAGAGAGAGGCTGG - Intronic
1007243838 6:40445789-40445811 CCACAGGGCCAGAAAGAGGCAGG - Intronic
1007321796 6:41033147-41033169 CTGCAGAGGGAGCCAGTGGCAGG + Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007341219 6:41192578-41192600 AGGCAGAGCCAGAAAGGGGCTGG - Intronic
1007726392 6:43918500-43918522 CTGCAGAGGCAAAAAAGAGCAGG + Intergenic
1008493277 6:52107546-52107568 GTGGAGAGGTAGAAAGAGCCTGG + Intergenic
1008786987 6:55180349-55180371 ATGCATAGGCAAAAAGAGGAAGG + Intronic
1009734852 6:67663188-67663210 CTGCAGTGGGAGAAAGATGCTGG + Intergenic
1010452296 6:76016563-76016585 ATGCTGATGCAGAGAGAGGCTGG + Intronic
1010579325 6:77574737-77574759 GTGAAGAGGCAGAAAGACACAGG + Intergenic
1010815785 6:80356882-80356904 AGGCAGAGGCAGAAGGAGTCGGG - Intergenic
1011419310 6:87155322-87155344 CAGCAGCGGCCGAAAGGGGCGGG - Intronic
1011659698 6:89583738-89583760 CTGCATAGGCAGTGAGGGGCAGG - Intronic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1011866458 6:91834716-91834738 CACCAGAAGCTGAAAGAGGCAGG + Intergenic
1012154980 6:95807865-95807887 CAGTAGATGCAGAAAGAGACAGG + Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1012948638 6:105494364-105494386 TTACAGAGACAGAAAGAGGGAGG + Intergenic
1013226839 6:108125290-108125312 CAGCAGAGGCAGAAGGCAGCAGG - Intronic
1013290781 6:108717246-108717268 CTGCATAGGAAGAGAGTGGCAGG + Intergenic
1014279854 6:119429692-119429714 AGGCAGAGACAGAGAGAGGCTGG + Intergenic
1014778127 6:125533788-125533810 TTGGGGAGGCAGAAAGGGGCAGG + Intergenic
1015950678 6:138549490-138549512 CAGCAGAAGCTGGAAGAGGCAGG + Intronic
1016971948 6:149772226-149772248 CTTCAGAGGCAGAAAGAAGCAGG + Intronic
1017481804 6:154864876-154864898 CTGCAGAAGAAGAATTAGGCTGG - Intronic
1017608805 6:156162478-156162500 CAGCAGAGGCTGGAAGAGACAGG + Intergenic
1018014654 6:159701227-159701249 CTACAGAGGGAGAAAGATGTTGG - Intronic
1018231558 6:161680659-161680681 CTGCAGTGGCAAACAGAGACAGG - Intronic
1018435127 6:163752433-163752455 CTGGTGAGGGAGAGAGAGGCCGG - Intergenic
1018733188 6:166668675-166668697 CTGAAGAGGCACAGGGAGGCTGG + Intronic
1019030670 6:169008140-169008162 AAGCAGAGGCAGAACGAAGCAGG + Intergenic
1019339997 7:504460-504482 CTGCTGAGGCAGGAGGGGGCTGG - Intronic
1019705699 7:2496193-2496215 ATGCAGAGGCAGCAGGAGGGAGG + Intergenic
1019742832 7:2683313-2683335 CCCCAGAAGCAGGAAGAGGCAGG - Intronic
1019768776 7:2870466-2870488 CTGCTCAGGCAGAGAGGGGCAGG - Intergenic
1020467314 7:8495663-8495685 ATGCAGAGGAAGAAAGAAGTGGG + Intronic
1022059880 7:26782998-26783020 CAGGAGAGGCAGAAAGAATCTGG - Intronic
1022395772 7:29987144-29987166 GTGCAGAGGGAGAAGGTGGCAGG - Intronic
1023641532 7:42263785-42263807 CTGCAGAGGCTGCAAGTGTCTGG + Intergenic
1023792433 7:43763465-43763487 CTGCAGAGGCAGAAAGACATTGG - Intronic
1024865378 7:53899943-53899965 TTGCAGAGGCTGCAGGAGGCAGG - Intergenic
1024934891 7:54702074-54702096 CTGTAGAGGCAGAGACAGGCGGG + Intergenic
1026138750 7:67686546-67686568 CTCCAGAGGCTGAGTGAGGCAGG + Intergenic
1026579543 7:71602591-71602613 CTGCAGAGGGAGAGAGAGAGAGG - Intronic
1026682099 7:72474793-72474815 GTGCAGAAGCGGCAAGAGGCAGG - Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026775189 7:73226788-73226810 CTCCAGAAGGAGGAAGAGGCCGG + Intergenic
1026979684 7:74519093-74519115 ATGCAGAGGCAGGAAGGGGAGGG + Intronic
1027016046 7:74780159-74780181 CTCCAGAAGGAGGAAGAGGCCGG + Intronic
1027071983 7:75165778-75165800 CTCCAGAAGGAGGAAGAGGCCGG - Intergenic
1027220564 7:76211266-76211288 AGGCAGAGGCACAAGGAGGCAGG + Intronic
1029127318 7:98303566-98303588 CTGAAGAGGCAGGCAGAGTCCGG + Intronic
1029366576 7:100120198-100120220 CTGCAGAGGCTGCAGGAGCCGGG + Intronic
1029679619 7:102099235-102099257 CTGCAAAGCCAGAAAGAAGCGGG - Intronic
1030557548 7:111045705-111045727 CTGTAGAGGCTGGAAAAGGCAGG + Intronic
1031242614 7:119266038-119266060 CTGCAGAGCCAGAGAGAGAGAGG - Intergenic
1031852037 7:126877165-126877187 TTGCAGAGAGAGAAAGAGGAAGG - Intronic
1031972355 7:128073976-128073998 CAGGAGAGGCAGAAAGACGCGGG - Intronic
1032069604 7:128795613-128795635 TTGCAGAGGAGGAAAGTGGCAGG + Intronic
1032919191 7:136526956-136526978 CTGCAGAGCCCCAAAGAGGGTGG + Intergenic
1033109355 7:138560927-138560949 CTGCAAAGGCATCAAAAGGCAGG - Intronic
1035077643 7:156191532-156191554 CTGCAAAACCAGACAGAGGCTGG - Intergenic
1035234771 7:157489142-157489164 CAGCAGAGGCCGGGAGAGGCAGG + Intergenic
1035771945 8:2154810-2154832 GTGCAGAGGCAGTGAGGGGCTGG - Intronic
1037666241 8:20972582-20972604 CTCCAGAGGCAGACAAAGGCTGG + Intergenic
1037745976 8:21644407-21644429 CTGGGAAGGCAGAGAGAGGCTGG - Intergenic
1038256881 8:25958416-25958438 GTGCAGATGGAGAAAGGGGCAGG - Intronic
1038449967 8:27633716-27633738 CCGCGGCGGCACAAAGAGGCCGG + Intergenic
1039178064 8:34832017-34832039 CTGCTGAGACAGAAAGAAGTGGG - Intergenic
1039380443 8:37079941-37079963 CTGAAGAGTCAGAATGGGGCGGG + Intergenic
1039634065 8:39144019-39144041 CTGCTGAGGCAGACACAGGAGGG + Intronic
1039836259 8:41258673-41258695 CTGCAGATGCATGAAGATGCAGG + Intergenic
1039966211 8:42285868-42285890 CCGTAGAGACAGAAAGAGGTGGG + Intronic
1040620486 8:49086348-49086370 TTGCAGAGGCAGACAGAGAGAGG + Intergenic
1040899604 8:52404378-52404400 CTGCTGAGACAGAAGGAGTCGGG + Intronic
1040974876 8:53178825-53178847 GTGCAGAGGCAGATAGAGCAGGG + Intergenic
1041706163 8:60848492-60848514 CTGGAGAGGAAGACAGAGGGGGG - Intronic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042454883 8:68989494-68989516 CTGCTTAGGCAGAAAGGGCCTGG - Intergenic
1042592814 8:70414265-70414287 AGGCAGAGGCAGAAAGAGAAGGG - Intergenic
1042709984 8:71706760-71706782 AAGAAAAGGCAGAAAGAGGCTGG + Intergenic
1042809433 8:72807518-72807540 ATGCAAAGGCAGATAGAAGCAGG - Intronic
1042906800 8:73780209-73780231 CATCAGAGGCTGGAAGAGGCAGG - Intronic
1043553669 8:81404476-81404498 CTGCAGACATAGAAAGAGACAGG + Intergenic
1043665552 8:82807112-82807134 CTCCAGAAGCAGAAAAAGACAGG - Intergenic
1044939095 8:97322214-97322236 CTCCAGAGGCAGACAGAGGTAGG + Intergenic
1045051926 8:98335257-98335279 CTTTAGAGGCAGAATGAGGTTGG - Intergenic
1045064748 8:98435299-98435321 CTGCATAGGCAGAGAGAAGGAGG + Intronic
1045356247 8:101391829-101391851 CTGCAGAGTCAGTGAGAGTCAGG - Intergenic
1045480088 8:102584831-102584853 CTGCAGAGTCTGAAAGAAGAGGG - Intergenic
1045949742 8:107838229-107838251 ATGCAGAGGCAGAAAGATAGGGG + Intergenic
1046258229 8:111729157-111729179 CTTCAGTAGCAGCAAGAGGCAGG - Intergenic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1047290488 8:123525287-123525309 CTGCAGAGGGACAAAGAAACTGG + Intronic
1047318414 8:123755276-123755298 GGGCTGAGGCAGCAAGAGGCTGG + Intergenic
1048420498 8:134273804-134273826 TTCCGGAGGCATAAAGAGGCTGG + Intergenic
1048766688 8:137852279-137852301 CTTCAGAGGCAGATGCAGGCTGG - Intergenic
1049164149 8:141116325-141116347 CAGCAGTGGCACAAGGAGGCTGG + Intergenic
1049361914 8:142215989-142216011 CTGCTGAGGCAGGCAGAGGCTGG - Intronic
1049468475 8:142764486-142764508 CTGCAGAGGCCGGGAGAGGTGGG + Exonic
1049558147 8:143293863-143293885 CTGCAAGGGCAGAGAGAGGTGGG + Intronic
1049825874 8:144667410-144667432 CTGCAGAGACAGGATGAGGGAGG - Intergenic
1049885803 9:25377-25399 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
1050725427 9:8643720-8643742 GTGCTGAGGCAGCAAGGGGCTGG - Intronic
1051175169 9:14353177-14353199 CTGTAGGGGCAGACAGAGGGTGG + Intronic
1051189350 9:14494774-14494796 CTTCAGAGGCACAAACATGCAGG - Intergenic
1051996180 9:23220283-23220305 ATGCTTAGGCAGATAGAGGCAGG - Intergenic
1052069708 9:24067251-24067273 GTGCAAGGGCAGAAAGAGCCAGG + Intergenic
1052351957 9:27467207-27467229 CTTTAGAGCCAGAAAGATGCAGG + Intronic
1052626476 9:30982172-30982194 CTGCAGAGGCAGTAACAGAGAGG - Intergenic
1052696751 9:31888423-31888445 CTGCTGAGGCAGACAGGGTCTGG - Intergenic
1052742427 9:32405998-32406020 GTGCAAAGGCAGAAAAAGGACGG - Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053784162 9:41641270-41641292 CAGAAGAGGCAGTTAGAGGCTGG + Intergenic
1055779549 9:79804915-79804937 CTTCACAAGCAGGAAGAGGCAGG - Intergenic
1056086491 9:83154720-83154742 ATGCAAAGACAGAAAAAGGCAGG - Intergenic
1056628860 9:88276153-88276175 CAACAGATGCAGAAAGAAGCTGG + Intergenic
1057397271 9:94691291-94691313 CTGCAGAGGCAGGAGCAGGGTGG - Intergenic
1058973251 9:110102161-110102183 CTACAGAGGTAGAAAGAGGCTGG - Intronic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059207371 9:112479487-112479509 CTCCAGTGGCAGAAAGAGCAAGG - Intronic
1059264482 9:113013453-113013475 CTGGTGAGGGAGAAATAGGCAGG - Intergenic
1059361118 9:113742722-113742744 CAACAGAAGCAGGAAGAGGCTGG - Intergenic
1059636063 9:116171763-116171785 CTGGAGAGGCAGTCAGATGCTGG + Intronic
1059687648 9:116652792-116652814 GTGCACATGAAGAAAGAGGCAGG - Intronic
1059695958 9:116730716-116730738 CAGAAGAGGCAGAATGATGCAGG + Intronic
1059763828 9:117364363-117364385 CTGCAGTGGCAAACAGAGGTTGG - Intronic
1059985657 9:119818053-119818075 TTGCAGAGGCTGAAAGGGGATGG - Intergenic
1060225419 9:121787165-121787187 CCACGGAGGCAGCAAGAGGCAGG - Intergenic
1060584882 9:124779747-124779769 CTGCAGAGCCAGCAGGAGTCTGG - Intronic
1060586650 9:124790730-124790752 CGGCAGAGGCAGTAGGAGACAGG + Intronic
1060732703 9:126048350-126048372 CTGCAGAGGCACAGAGGGGAGGG + Intergenic
1061493360 9:130958275-130958297 CTGCAGGGACACAAAGTGGCAGG - Intergenic
1061705142 9:132447294-132447316 CTGCATCCCCAGAAAGAGGCAGG - Intronic
1061890015 9:133614168-133614190 CTCCTGAGGCAGGCAGAGGCAGG + Intergenic
1061892243 9:133629059-133629081 AGACAAAGGCAGAAAGAGGCAGG - Intergenic
1062215061 9:135384612-135384634 CAGCAGAGTCAGGGAGAGGCAGG - Intergenic
1062235094 9:135504059-135504081 CTGCAGGGCCAGAAGGAGCCCGG + Exonic
1185841047 X:3391523-3391545 ATGGAGAGGCAGAAAGTGACAGG + Intergenic
1186952813 X:14646216-14646238 CTGCATAGCCAGTAAGTGGCAGG + Intronic
1187341439 X:18425264-18425286 CTGGAGAGGCTGAGAGGGGCGGG - Intergenic
1187536880 X:20149053-20149075 GTGAAGAGGCAGCAAGAGGGCGG + Intergenic
1188514146 X:30967057-30967079 AGGCAGAGGCAGAAAGAGATTGG + Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1189984722 X:46544084-46544106 CTGCAAAGGCGGGATGAGGCTGG - Intronic
1190339155 X:49282693-49282715 CAGCAGGGGCAGAACGAGGGAGG + Intronic
1190458684 X:50649286-50649308 CTGCAGTGCTAGAAAGAGGTTGG + Intronic
1190927158 X:54920770-54920792 CTCTGGAGGCGGAAAGAGGCAGG + Intronic
1193034565 X:76935018-76935040 TTCCAGAGGAAGAAACAGGCAGG + Intergenic
1193789124 X:85797308-85797330 CTGCAGAGGCAGTAACAGAGAGG + Intergenic
1197754573 X:129984514-129984536 CTGCAGGGGCGCCAAGAGGCCGG + Intronic
1197846361 X:130807830-130807852 CTGCACAGTCAGTAAGTGGCAGG - Intronic
1198101348 X:133424813-133424835 TTGCACAGGCAAAAAGAGACAGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199533180 X:148872309-148872331 CTGTAGAGACTGAAAGAGACTGG - Intronic
1199680286 X:150219764-150219786 CTGCGGAGGCAGAGGAAGGCTGG + Intergenic
1199786662 X:151112256-151112278 CTGCAGTGGGAGAAGGATGCGGG + Intergenic
1199871474 X:151902292-151902314 CTGCAGGGGTGGAGAGAGGCTGG + Intergenic
1200234545 X:154461949-154461971 CTGCGGAGGGAGACAGAGGAGGG - Intronic
1201909424 Y:19119322-19119344 CACCAGAGGCAGAATGAAGCTGG - Intergenic