ID: 1058975915

View in Genome Browser
Species Human (GRCh38)
Location 9:110125439-110125461
Sequence CCTTTTAGGGAGCAGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058975904_1058975915 22 Left 1058975904 9:110125394-110125416 CCAGGCCTCTCCGAAGGAGGTTA 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG No data
1058975906_1058975915 12 Left 1058975906 9:110125404-110125426 CCGAAGGAGGTTAAAGTCCTTCT 0: 1
1: 0
2: 0
3: 14
4: 144
Right 1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG No data
1058975905_1058975915 17 Left 1058975905 9:110125399-110125421 CCTCTCCGAAGGAGGTTAAAGTC 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG No data
1058975908_1058975915 -5 Left 1058975908 9:110125421-110125443 CCTTCTTTGTGTGAATGGCCTTT 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058975915 Original CRISPR CCTTTTAGGGAGCAGAGGGA GGG Intronic
No off target data available for this crispr