ID: 1058982894

View in Genome Browser
Species Human (GRCh38)
Location 9:110186637-110186659
Sequence GGGTTTCAAGAGAGTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058982886_1058982894 3 Left 1058982886 9:110186611-110186633 CCAGAAGCCCATTTAAAATGGGT No data
Right 1058982894 9:110186637-110186659 GGGTTTCAAGAGAGTGAGCAGGG No data
1058982890_1058982894 -5 Left 1058982890 9:110186619-110186641 CCATTTAAAATGGGTCCCGGGTT No data
Right 1058982894 9:110186637-110186659 GGGTTTCAAGAGAGTGAGCAGGG No data
1058982889_1058982894 -4 Left 1058982889 9:110186618-110186640 CCCATTTAAAATGGGTCCCGGGT No data
Right 1058982894 9:110186637-110186659 GGGTTTCAAGAGAGTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058982894 Original CRISPR GGGTTTCAAGAGAGTGAGCA GGG Intergenic
No off target data available for this crispr