ID: 1058985768

View in Genome Browser
Species Human (GRCh38)
Location 9:110207507-110207529
Sequence TAGGTCTCACTTAATGGCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 149}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058985768_1058985772 -6 Left 1058985768 9:110207507-110207529 CCTCAGCCATTAAGTGAGACCTA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1058985772 9:110207524-110207546 GACCTAAGCTGCCAGAAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 120
1058985768_1058985771 -7 Left 1058985768 9:110207507-110207529 CCTCAGCCATTAAGTGAGACCTA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1058985771 9:110207523-110207545 AGACCTAAGCTGCCAGAAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 128
1058985768_1058985780 10 Left 1058985768 9:110207507-110207529 CCTCAGCCATTAAGTGAGACCTA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1058985780 9:110207540-110207562 AGTGGGGCAGGGCTGGGCACGGG 0: 1
1: 1
2: 7
3: 92
4: 906
1058985768_1058985776 3 Left 1058985768 9:110207507-110207529 CCTCAGCCATTAAGTGAGACCTA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1058985776 9:110207533-110207555 TGCCAGAAGTGGGGCAGGGCTGG 0: 1
1: 0
2: 4
3: 62
4: 565
1058985768_1058985775 -1 Left 1058985768 9:110207507-110207529 CCTCAGCCATTAAGTGAGACCTA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1058985775 9:110207529-110207551 AAGCTGCCAGAAGTGGGGCAGGG 0: 1
1: 0
2: 1
3: 23
4: 324
1058985768_1058985779 9 Left 1058985768 9:110207507-110207529 CCTCAGCCATTAAGTGAGACCTA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1058985779 9:110207539-110207561 AAGTGGGGCAGGGCTGGGCACGG 0: 1
1: 0
2: 24
3: 198
4: 1845
1058985768_1058985774 -2 Left 1058985768 9:110207507-110207529 CCTCAGCCATTAAGTGAGACCTA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1058985774 9:110207528-110207550 TAAGCTGCCAGAAGTGGGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 221
1058985768_1058985781 14 Left 1058985768 9:110207507-110207529 CCTCAGCCATTAAGTGAGACCTA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1058985781 9:110207544-110207566 GGGCAGGGCTGGGCACGGGCAGG 0: 1
1: 0
2: 27
3: 248
4: 2031
1058985768_1058985777 4 Left 1058985768 9:110207507-110207529 CCTCAGCCATTAAGTGAGACCTA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1058985777 9:110207534-110207556 GCCAGAAGTGGGGCAGGGCTGGG 0: 1
1: 0
2: 6
3: 58
4: 706
1058985768_1058985782 15 Left 1058985768 9:110207507-110207529 CCTCAGCCATTAAGTGAGACCTA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1058985782 9:110207545-110207567 GGCAGGGCTGGGCACGGGCAGGG 0: 1
1: 0
2: 14
3: 125
4: 1137
1058985768_1058985770 -8 Left 1058985768 9:110207507-110207529 CCTCAGCCATTAAGTGAGACCTA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1058985770 9:110207522-110207544 GAGACCTAAGCTGCCAGAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058985768 Original CRISPR TAGGTCTCACTTAATGGCTG AGG (reversed) Exonic
901141554 1:7036878-7036900 GAGGTCTCTCTTCGTGGCTGTGG + Intronic
901283917 1:8061229-8061251 TAGTTCCCACCTTATGGCTGAGG + Intergenic
902224552 1:14988410-14988432 TAGGACTCACTTAAGGAATGAGG + Intronic
902715428 1:18269481-18269503 TCAGTCTCACTTCTTGGCTGAGG - Intronic
908242923 1:62203011-62203033 GAGGTCTCACTGCATTGCTGAGG + Intronic
908386521 1:63647701-63647723 AAGGTCTCACTGCAAGGCTGTGG - Intronic
908603503 1:65767033-65767055 CAGGTCTCACTATATTGCTGTGG - Intergenic
909574971 1:77164441-77164463 CATTTCTCACTTTATGGCTGAGG - Intronic
913104575 1:115600648-115600670 AAGGTCTCACTATGTGGCTGAGG - Intergenic
913663345 1:121024170-121024192 TAGGTCTCTCTTAAAGGCCATGG - Intergenic
914014732 1:143807434-143807456 TAGGTCTCTCTTAAAGGCCATGG - Intergenic
914653355 1:149715992-149716014 TAGGTCTCTCTTAAAGGCCATGG - Intergenic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
916188072 1:162152299-162152321 TAGCTCTCATGTGATGGCTGAGG + Intronic
916517924 1:165537449-165537471 CTGCTCTCACTTAATAGCTGTGG - Intergenic
919173700 1:193991601-193991623 TAGGTCTCACTATATTGCTCAGG - Intergenic
919338819 1:196276501-196276523 TAGGTCTCCCTTTATGCTTGGGG + Intronic
919684035 1:200465081-200465103 TCGGTCTCAGTTCATGGCTTGGG + Intergenic
1064441932 10:15361708-15361730 TAGGACTCACTTTATGGATTGGG + Intronic
1065486812 10:26243681-26243703 GAGGTATCAATTACTGGCTGGGG - Intronic
1065781766 10:29175435-29175457 TATGTCTAACCTAATGGGTGTGG - Intergenic
1066641942 10:37562691-37562713 TAGGTTTCATTTACTGGCTCTGG + Intergenic
1068879370 10:62032293-62032315 AGGGTCTCACTTTATTGCTGAGG - Intronic
1070028247 10:72652133-72652155 TTGGTGTCATTTAATTGCTGTGG - Intergenic
1072289035 10:93945576-93945598 TAGGTCAGACTCAGTGGCTGTGG + Intronic
1073436131 10:103517216-103517238 GAGGTCTCACTATATTGCTGAGG + Intronic
1074054209 10:109907527-109907549 TAGGTCTCACTGAATGCTTGTGG - Intronic
1080985264 11:37455695-37455717 TAGCTCTCACATAATGGCTCAGG - Intergenic
1082642654 11:55684056-55684078 TAGCTCTCACATAATAGTTGTGG + Intergenic
1087836336 11:102879150-102879172 GAGGTCTCACTCTATTGCTGAGG + Intergenic
1101227443 12:102703873-102703895 TATGTCTCACTTCATGTCTTTGG - Intergenic
1105033237 12:132899763-132899785 TATGCCTCACTTTATGGCTTGGG + Intronic
1107137732 13:36962623-36962645 TTGACCTCACTTAGTGGCTGGGG - Intronic
1107182498 13:37477690-37477712 TATGTCTCAGTCAATGTCTGGGG + Intergenic
1109516896 13:63455493-63455515 CAGGTCTCCCTTAATTGCAGTGG - Intergenic
1110579686 13:77107227-77107249 TAGGTCTAACTTTATAGTTGAGG + Intronic
1111116053 13:83779527-83779549 TTGGTCTCAGTTCATGTCTGAGG - Intergenic
1112243391 13:97704535-97704557 TATGGCTCACTTAATGGCTTTGG + Intergenic
1113402586 13:110007431-110007453 TAGTTCTCACTTTATGAGTGTGG - Intergenic
1114356264 14:21912508-21912530 TAGGTCTTTCTTTATGGCTCAGG + Intergenic
1117414124 14:55478138-55478160 TAGATCACACTTAAATGCTGGGG + Intergenic
1117814828 14:59586426-59586448 CAGGTCTCATTTACTGGCTGTGG + Intergenic
1120468066 14:84886163-84886185 TAGGTCTCACCCAAGGCCTGTGG - Intergenic
1120930201 14:89840731-89840753 TAGGGATCTCTTAATGGCAGCGG + Intronic
1121722538 14:96120329-96120351 TATGTCTCACTTTATGTCTACGG + Intergenic
1127424583 15:58842805-58842827 TTATTCTCACTTAATGGCTGAGG + Intronic
1129637246 15:77333174-77333196 GAGGTCTCACTTTATTGCTCAGG + Intronic
1130212876 15:81942196-81942218 TGGGCCTCCCTGAATGGCTGTGG - Intergenic
1134462974 16:14445879-14445901 TAGGACAGACTTAATGGCTCTGG + Intronic
1134846065 16:17441745-17441767 TAAGTGTCAGATAATGGCTGAGG + Intronic
1137831036 16:51543644-51543666 TGGGTCTCTCTTAATGACCGGGG - Intergenic
1139019831 16:62734223-62734245 TTGGTCAGACTTAATGGTTGAGG + Intergenic
1139514318 16:67444417-67444439 CAGGTCTCACTTTCTGGCTCAGG + Intronic
1139598821 16:67974004-67974026 GAGGTCTCACTAAATTGCTCAGG + Intergenic
1141069963 16:80945237-80945259 TAGGTCTTACTTTAGGGCAGTGG + Intergenic
1142011204 16:87715143-87715165 TAGGTCCCAGGTAATGGGTGTGG - Intronic
1144367811 17:14561434-14561456 TAGGTCTCACCTTAGAGCTGAGG - Intergenic
1144831613 17:18134904-18134926 AGGGTCTCACTTTATGGCTCAGG + Intronic
1145919576 17:28600256-28600278 TAGGTCTCACTATATTGCCGAGG - Intronic
1146696425 17:34911934-34911956 AAGGGCTCACTAGATGGCTGTGG + Intergenic
1148141216 17:45330222-45330244 GAGCTCTCAATTAATGACTGAGG + Intergenic
1150630443 17:66876863-66876885 TAGGTCGCATTTAATTGCTTTGG + Intronic
1153972845 18:10242225-10242247 TAGGTCTCTCCTCATTGCTGTGG + Intergenic
1156055622 18:32999102-32999124 TGGCTCTCACTTCAGGGCTGTGG - Intronic
1157740589 18:50089544-50089566 GAGGTCTCACTTTATTGCTCAGG - Intronic
1158771655 18:60524396-60524418 GAGGTCTCACTTTGTTGCTGAGG - Intergenic
1159403649 18:67971792-67971814 TAGGGCCCACTTAAGGGCTGAGG - Intergenic
1160766268 19:809695-809717 GAGGTCTCACTTTATTGCTCAGG - Intronic
1164012596 19:21218524-21218546 TATGTGGCACTTATTGGCTGAGG - Intergenic
1164462125 19:28457887-28457909 TGGGTCTCACTTTGTTGCTGAGG + Intergenic
1168539961 19:57202012-57202034 TGGGTCTCACTTTATTGCTCAGG - Intronic
925255016 2:2475890-2475912 GAGGGCTCACTCAATGGCTTGGG + Intergenic
925866445 2:8232152-8232174 TAGGCCTCACTGAATGCTTGGGG - Intergenic
926042756 2:9687859-9687881 TATGTACTACTTAATGGCTGAGG + Intergenic
926114424 2:10203382-10203404 TACCTCCCACTTAATGGTTGAGG - Intronic
927666772 2:25038315-25038337 TATGTCTCACCTACTGCCTGGGG + Intergenic
927700847 2:25267971-25267993 AAGGTCCCACTTACTGGGTGTGG - Intronic
928272500 2:29869056-29869078 TGGGGGTGACTTAATGGCTGGGG - Intronic
930236944 2:48897666-48897688 CAGGTCTCTCTTACTGGGTGGGG + Intergenic
935478513 2:103556462-103556484 TGGGTCTCACTCAAGGCCTGTGG + Intergenic
936002404 2:108846485-108846507 TGGGTCTCACTAAGTTGCTGAGG - Intronic
936914102 2:117622599-117622621 AAGATCTCACTTCATTGCTGAGG - Intergenic
942511063 2:176701974-176701996 TGGGTCTCGCTTAAAGCCTGTGG + Intergenic
943106654 2:183552072-183552094 CAGGTATCTCTTAATGGATGAGG + Intergenic
947133912 2:226957529-226957551 TAGGTCTCACTTCAAGACTCAGG - Intronic
1168984139 20:2033353-2033375 AAGGTATCACTTAAAGGCTGAGG + Intergenic
1169464629 20:5826849-5826871 TAGGTTTCACGTAAGTGCTGTGG + Intronic
1171943022 20:31349262-31349284 TGGGTCTCACTCAAGGCCTGTGG - Intergenic
1183415864 22:37681524-37681546 TGGGTCTCATTTTATGGATGAGG - Intergenic
950864618 3:16179238-16179260 TAGGTTTCATTTCATGGATGAGG + Intronic
955217934 3:57000035-57000057 TTAGTCTCATTTTATGGCTGAGG - Intronic
955744064 3:62122509-62122531 TAGTTTACACTTAATTGCTGTGG + Intronic
956598678 3:70995632-70995654 TAGATCCCAGTTAATAGCTGGGG + Intronic
962498961 3:135969618-135969640 TAGGTGTAAATTAAAGGCTGTGG + Intronic
963644650 3:147898140-147898162 TAGGTCTGTGTTAATGGATGAGG - Intergenic
963865198 3:150353006-150353028 TAATTCTCACTGAATAGCTGAGG - Intergenic
964734617 3:159903744-159903766 GAGGTCTCACTTTGTAGCTGAGG + Intergenic
965366312 3:167804639-167804661 TGGGTCTCACTTTATTGCTGAGG - Intronic
965937887 3:174137631-174137653 TATGTGTCATTTAATGCCTGAGG + Intronic
973060662 4:45719569-45719591 TAGGTCTCACCGAAAGCCTGTGG - Intergenic
974812486 4:66962788-66962810 TAGGTCTCAATTAATTACTGTGG + Intergenic
975686519 4:76921249-76921271 AAGGTCTCACTTTGTGGCTCAGG + Intergenic
977958153 4:103054084-103054106 AGGGTCTCACTTTATGGCTCAGG - Intronic
980677466 4:136105973-136105995 TAGGTTTCACTTAAGGTCTTAGG - Intergenic
983081282 4:163387934-163387956 TGGGTTACACTTTATGGCTGTGG - Intergenic
983406261 4:167335087-167335109 TAGGTGTTACTGACTGGCTGGGG - Intergenic
984524435 4:180841079-180841101 TATATCTTACTTAATGGCTTTGG - Intergenic
984681657 4:182617592-182617614 AAGTTCTCACTTAAGAGCTGAGG - Intronic
987121423 5:14771506-14771528 TAGGTCTCATTCACTGGCTCTGG + Intronic
987981844 5:25095966-25095988 TAGCTAGCATTTAATGGCTGAGG + Intergenic
988664384 5:33309154-33309176 TAAGTTTAACTTAATGGCTTTGG - Intergenic
995722096 5:115147216-115147238 AAGGTCACACATAATGGCTGTGG + Exonic
997366590 5:133329263-133329285 TTGGTAGCACTTAATGGGTGGGG + Intronic
998689303 5:144570037-144570059 TGGGTCTCACTGAAGGCCTGTGG + Intergenic
998864114 5:146477721-146477743 TGGGTCTCACTTTATTGCTCAGG + Intronic
1001961864 5:175884410-175884432 TAGGTCTCCCTCAGTGTCTGGGG - Intergenic
1003669739 6:8145722-8145744 AAGGTCTCATTAAATGGCTCAGG - Intergenic
1005037717 6:21572068-21572090 GAGGTCTCACTATATTGCTGAGG + Intergenic
1006390421 6:33755042-33755064 TATGTCTCACCTGATGGCTGCGG - Intergenic
1010230870 6:73534085-73534107 AAGGTCTCACTTTGTTGCTGAGG - Intergenic
1010244429 6:73650167-73650189 AAGGTCTCACTTAGTTGCTCAGG - Intronic
1014099762 6:117498952-117498974 CAAGTCTCACTTAATTGCTATGG + Intronic
1014187295 6:118449836-118449858 TAGGTCTCACTCACTGCTTGTGG + Intergenic
1014469267 6:121794706-121794728 TAGCTCTCACATAATGGAGGGGG - Intergenic
1014591033 6:123270465-123270487 TGGGATTCTCTTAATGGCTGAGG + Intronic
1014880330 6:126716199-126716221 TAGGTCTAAAGTAATGGCAGAGG - Intergenic
1026872776 7:73863234-73863256 TTGGTGTCACTCAAGGGCTGGGG + Intronic
1028181476 7:87730095-87730117 TGGGTCTCACTCAAGGCCTGTGG - Intronic
1029087053 7:98019995-98020017 GAGGTCTCACTTTATTGCTCAGG + Intergenic
1029284273 7:99455328-99455350 TAGGGCTAACATGATGGCTGGGG - Intronic
1030383377 7:108839501-108839523 TAGTTCTCAGTTATTGGATGAGG + Intergenic
1031260064 7:119507141-119507163 TGGGTCTCACTCAAGGCCTGTGG - Intergenic
1031546078 7:123052972-123052994 TGGGTCTCACTCAAGGCCTGCGG + Intergenic
1032618001 7:133496356-133496378 AAGGTCTCACTTTTTTGCTGAGG + Intronic
1033080325 7:138290597-138290619 GGGGTCTCACTCTATGGCTGAGG + Intergenic
1033409992 7:141108684-141108706 TTGGGCTCACTTGAGGGCTGTGG + Intronic
1035548579 8:502568-502590 TAGGTCCCACTGCATGGCTCTGG - Intronic
1036582287 8:10086561-10086583 TAGGTATTACTTTATGGATGAGG - Intronic
1037173702 8:15923417-15923439 TAGGTCTCACTATATGGCCCAGG - Intergenic
1038043030 8:23742725-23742747 GAGGTCTCACTATATTGCTGAGG - Intergenic
1041089184 8:54286235-54286257 TAGGCCTCACTTTAAAGCTGAGG + Intergenic
1042749611 8:72143886-72143908 TGGATCTCATATAATGGCTGGGG + Intergenic
1043969214 8:86511688-86511710 TAGGTCCCAGCTACTGGCTGAGG + Intronic
1048936749 8:139363919-139363941 ATGGTCCCACTTAATGGGTGTGG - Intergenic
1049063006 8:140290913-140290935 TAGGTTTTACTTAATGTCTGAGG - Intronic
1050260726 9:3838327-3838349 TAGGTCTCTCTTAAGTACTGGGG - Intronic
1054358228 9:64085623-64085645 GAGGTCTCACTGTATTGCTGAGG + Intergenic
1055083251 9:72288877-72288899 TAGTTCTCATTTAATGTCTCTGG + Intergenic
1055326999 9:75141105-75141127 GAGGTCTCACTTTATTGCTCAGG - Intronic
1057095722 9:92306789-92306811 TAGGTCTCTTTTAATGGCCTGGG - Intronic
1057629981 9:96711777-96711799 TTTGTCTCACTTAAGCGCTGTGG + Intergenic
1058985768 9:110207507-110207529 TAGGTCTCACTTAATGGCTGAGG - Exonic
1059517685 9:114910938-114910960 TAATTCTCACTTAATGGATGTGG - Intronic
1185509823 X:655411-655433 AAGGTCTCACTTTGTTGCTGAGG - Intronic
1190277780 X:48910248-48910270 GAGGTGTCAGGTAATGGCTGAGG + Exonic
1190507833 X:51145258-51145280 TGGGTCTCACTCAAGGCCTGTGG + Intergenic
1191116988 X:56862999-56863021 TATGTCTCATTTACTGGCTCTGG + Intergenic
1191194086 X:57703198-57703220 TATGTCTCACTTAAGACCTGTGG + Intergenic
1193742436 X:85232972-85232994 GGGGTCTCACTTAAGGCCTGCGG - Intergenic
1193846970 X:86483804-86483826 TAGGTCTCACTATGTTGCTGAGG - Intronic
1195870476 X:109480339-109480361 TTGTTCTCTCTTAAGGGCTGGGG + Intronic
1196043463 X:111231187-111231209 TAATTCTCACTTAGAGGCTGGGG - Intergenic
1201951394 Y:19567864-19567886 TCGGTCTCACCGACTGGCTGCGG - Intergenic