ID: 1058987907

View in Genome Browser
Species Human (GRCh38)
Location 9:110225797-110225819
Sequence AGAGAGAAGGAGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058987907_1058987911 2 Left 1058987907 9:110225797-110225819 CCCTCCTCACTCTCCTTCTCTCT No data
Right 1058987911 9:110225822-110225844 TTCCTGCCACCATGTAAAGAAGG 0: 12
1: 239
2: 1223
3: 2014
4: 2623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058987907 Original CRISPR AGAGAGAAGGAGAGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr