ID: 1058993267

View in Genome Browser
Species Human (GRCh38)
Location 9:110275082-110275104
Sequence TACTACTGCATTCCAGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058993262_1058993267 11 Left 1058993262 9:110275048-110275070 CCTGGGAGGTGGAGATTGCAGTG 0: 1422
1: 44650
2: 136523
3: 191781
4: 172980
Right 1058993267 9:110275082-110275104 TACTACTGCATTCCAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058993267 Original CRISPR TACTACTGCATTCCAGCCTG GGG Intergenic
No off target data available for this crispr